Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639246_at:

>probe:Drosophila_2:1639246_at:727:561; Interrogation_Position=1785; Antisense; GGAACGAGATCAGCGACTCCAGACT
>probe:Drosophila_2:1639246_at:155:283; Interrogation_Position=1801; Antisense; CTCCAGACTGTTTCTCATCACAAGA
>probe:Drosophila_2:1639246_at:332:393; Interrogation_Position=1824; Antisense; GAAAGCACACCTTAGGTCGCATTAT
>probe:Drosophila_2:1639246_at:367:397; Interrogation_Position=1868; Antisense; GACACACTGAGTGAGACCTTGAGTA
>probe:Drosophila_2:1639246_at:527:635; Interrogation_Position=1893; Antisense; TCGAAGATTTCTTGTCCGTGCAAAA
>probe:Drosophila_2:1639246_at:235:101; Interrogation_Position=1968; Antisense; AGAGGATGCGAACCCAGTTCCTCAT
>probe:Drosophila_2:1639246_at:515:93; Interrogation_Position=1983; Antisense; AGTTCCTCATGGACGTTCATCTCAC
>probe:Drosophila_2:1639246_at:523:105; Interrogation_Position=2091; Antisense; AGACAGACCTGCGTAGACGTCTCTA
>probe:Drosophila_2:1639246_at:520:445; Interrogation_Position=2140; Antisense; GATGCGTCAGCAGTCAAGGGATATG
>probe:Drosophila_2:1639246_at:318:223; Interrogation_Position=2155; Antisense; AAGGGATATGACCTTCCACGGCGGC
>probe:Drosophila_2:1639246_at:598:445; Interrogation_Position=2188; Antisense; GATGCCCTCGCTGATGTACGACTAC
>probe:Drosophila_2:1639246_at:674:487; Interrogation_Position=2203; Antisense; GTACGACTACGACAACACTGTGGAG
>probe:Drosophila_2:1639246_at:146:391; Interrogation_Position=2246; Antisense; GAAACGGTGGCCAAGCTCAGGGAAA
>probe:Drosophila_2:1639246_at:412:627; Interrogation_Position=2283; Antisense; TCCAACGTCGGCTCAGCTATGTAGA

Paste this into a BLAST search page for me
GGAACGAGATCAGCGACTCCAGACTCTCCAGACTGTTTCTCATCACAAGAGAAAGCACACCTTAGGTCGCATTATGACACACTGAGTGAGACCTTGAGTATCGAAGATTTCTTGTCCGTGCAAAAAGAGGATGCGAACCCAGTTCCTCATAGTTCCTCATGGACGTTCATCTCACAGACAGACCTGCGTAGACGTCTCTAGATGCGTCAGCAGTCAAGGGATATGAAGGGATATGACCTTCCACGGCGGCGATGCCCTCGCTGATGTACGACTACGTACGACTACGACAACACTGTGGAGGAAACGGTGGCCAAGCTCAGGGAAATCCAACGTCGGCTCAGCTATGTAGA

Full Affymetrix probeset data:

Annotations for 1639246_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime