FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639247_at:

>probe:Drosophila_2:1639247_at:672:541; Interrogation_Position=193; Antisense; GGTTCCCTCAACCAGGAGTCGAGCT
>probe:Drosophila_2:1639247_at:53:433; Interrogation_Position=208; Antisense; GAGTCGAGCTTATTGTTCTCCAAAA
>probe:Drosophila_2:1639247_at:149:165; Interrogation_Position=230; Antisense; AAATCACCACTGTCTCCGAGTTTTA
>probe:Drosophila_2:1639247_at:345:149; Interrogation_Position=269; Antisense; ACATTGGCTCCTACAACACGGACTT
>probe:Drosophila_2:1639247_at:214:219; Interrogation_Position=301; Antisense; AAGTCCTATGGAGACGACGGCTTGA
>probe:Drosophila_2:1639247_at:596:407; Interrogation_Position=316; Antisense; GACGGCTTGAGCCTGACCGACAAAT
>probe:Drosophila_2:1639247_at:552:181; Interrogation_Position=342; Antisense; AAAACAGAGGCGCATTCGCACCACT
>probe:Drosophila_2:1639247_at:109:373; Interrogation_Position=396; Antisense; GAAGATCTTCCTGGAAACCCACTAC
>probe:Drosophila_2:1639247_at:450:375; Interrogation_Position=439; Antisense; GAAGAGATCGCATCCAAGCTGCACT
>probe:Drosophila_2:1639247_at:730:615; Interrogation_Position=458; Antisense; TGCACTTGACGGAAGCTCGAGTTCA
>probe:Drosophila_2:1639247_at:29:441; Interrogation_Position=568; Antisense; GATGGCCGGAAGAATCCTGTAGCAG
>probe:Drosophila_2:1639247_at:442:77; Interrogation_Position=591; Antisense; AGGATCGAAATACCTGGGCCCATCT
>probe:Drosophila_2:1639247_at:237:221; Interrogation_Position=619; Antisense; AAGGGACCCCAGAATGGCCATGGCC
>probe:Drosophila_2:1639247_at:482:579; Interrogation_Position=634; Antisense; GGCCATGGCCGTCAAATGAAATGCT

Paste this into a BLAST search page for me
GGTTCCCTCAACCAGGAGTCGAGCTGAGTCGAGCTTATTGTTCTCCAAAAAAATCACCACTGTCTCCGAGTTTTAACATTGGCTCCTACAACACGGACTTAAGTCCTATGGAGACGACGGCTTGAGACGGCTTGAGCCTGACCGACAAATAAAACAGAGGCGCATTCGCACCACTGAAGATCTTCCTGGAAACCCACTACGAAGAGATCGCATCCAAGCTGCACTTGCACTTGACGGAAGCTCGAGTTCAGATGGCCGGAAGAATCCTGTAGCAGAGGATCGAAATACCTGGGCCCATCTAAGGGACCCCAGAATGGCCATGGCCGGCCATGGCCGTCAAATGAAATGCT

Full Affymetrix probeset data:

Annotations for 1639247_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720