FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639248_at:

>probe:Drosophila_2:1639248_at:526:407; Interrogation_Position=2833; Antisense; GACGGGCAAATCGTGTGCCATTCAA
>probe:Drosophila_2:1639248_at:634:417; Interrogation_Position=2873; Antisense; GAGCGTAGATCATTTGACCAGCAGA
>probe:Drosophila_2:1639248_at:574:409; Interrogation_Position=2955; Antisense; GACCCAGGCGTTCCTACGAAATGAG
>probe:Drosophila_2:1639248_at:440:221; Interrogation_Position=3004; Antisense; AAGTGGCAGCGGTCTGCGCCAGCAT
>probe:Drosophila_2:1639248_at:590:67; Interrogation_Position=3084; Antisense; ATGGCACTGTGCGTCACTACGATTT
>probe:Drosophila_2:1639248_at:319:681; Interrogation_Position=3110; Antisense; TATCGCGACAGAGAGTTACCCGTGG
>probe:Drosophila_2:1639248_at:640:705; Interrogation_Position=3125; Antisense; TTACCCGTGGAGGAGCTCATGGACA
>probe:Drosophila_2:1639248_at:357:67; Interrogation_Position=3143; Antisense; ATGGACACACGCCTCAAGGTGACGG
>probe:Drosophila_2:1639248_at:264:223; Interrogation_Position=3158; Antisense; AAGGTGACGGACATTGCCGGTGCTC
>probe:Drosophila_2:1639248_at:200:723; Interrogation_Position=3171; Antisense; TTGCCGGTGCTCGAAGTTGTGGACA
>probe:Drosophila_2:1639248_at:729:399; Interrogation_Position=3192; Antisense; GACAGGAACAGGTTCTGCTCATCCT
>probe:Drosophila_2:1639248_at:684:619; Interrogation_Position=3207; Antisense; TGCTCATCCTGGACTCGACTGGAAA
>probe:Drosophila_2:1639248_at:616:355; Interrogation_Position=3243; Antisense; GCACTCTGGACTACTAGCTTGTTAA
>probe:Drosophila_2:1639248_at:3:663; Interrogation_Position=3320; Antisense; TAAACTCGAACTAGTCCTACTCACT

Paste this into a BLAST search page for me
GACGGGCAAATCGTGTGCCATTCAAGAGCGTAGATCATTTGACCAGCAGAGACCCAGGCGTTCCTACGAAATGAGAAGTGGCAGCGGTCTGCGCCAGCATATGGCACTGTGCGTCACTACGATTTTATCGCGACAGAGAGTTACCCGTGGTTACCCGTGGAGGAGCTCATGGACAATGGACACACGCCTCAAGGTGACGGAAGGTGACGGACATTGCCGGTGCTCTTGCCGGTGCTCGAAGTTGTGGACAGACAGGAACAGGTTCTGCTCATCCTTGCTCATCCTGGACTCGACTGGAAAGCACTCTGGACTACTAGCTTGTTAATAAACTCGAACTAGTCCTACTCACT

Full Affymetrix probeset data:

Annotations for 1639248_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720