Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639251_at:

>probe:Drosophila_2:1639251_at:276:135; Interrogation_Position=1056; Antisense; ACGCTCGGCGAGAACAACTGGCAGT
>probe:Drosophila_2:1639251_at:231:197; Interrogation_Position=1071; Antisense; AACTGGCAGTCGGTGCTTTGCATAG
>probe:Drosophila_2:1639251_at:560:675; Interrogation_Position=1093; Antisense; TAGAGGATCCAGTGACGCCGACCAA
>probe:Drosophila_2:1639251_at:700:525; Interrogation_Position=1168; Antisense; GGGCAGCCTTCGTGAAGCTCTCGAA
>probe:Drosophila_2:1639251_at:245:117; Interrogation_Position=1183; Antisense; AGCTCTCGAAGCTGGTGGACTCCGA
>probe:Drosophila_2:1639251_at:352:191; Interrogation_Position=1239; Antisense; AACATTGTAGAGGTGCCGCAGTCCA
>probe:Drosophila_2:1639251_at:130:193; Interrogation_Position=1269; Antisense; AACTACCGGGCTTGGGTGCACTACA
>probe:Drosophila_2:1639251_at:285:397; Interrogation_Position=1310; Antisense; GACACCGGAATTGCCTTGTGCCGAT
>probe:Drosophila_2:1639251_at:579:463; Interrogation_Position=1429; Antisense; GATTCGGCCGATGTGATGATCCTCC
>probe:Drosophila_2:1639251_at:551:443; Interrogation_Position=1443; Antisense; GATGATCCTCCCCAAAACATAGACA
>probe:Drosophila_2:1639251_at:681:149; Interrogation_Position=1459; Antisense; ACATAGACATAGTTGCCGACCTTGC
>probe:Drosophila_2:1639251_at:237:489; Interrogation_Position=1508; Antisense; GTACGCTTATACTACCAGTGATTTT
>probe:Drosophila_2:1639251_at:314:141; Interrogation_Position=973; Antisense; ACGGCCGCAAGTTTGACTTCTTCAA
>probe:Drosophila_2:1639251_at:352:91; Interrogation_Position=997; Antisense; AGTATGGAATTTCTGTCCTCGGCCA

Paste this into a BLAST search page for me
ACGCTCGGCGAGAACAACTGGCAGTAACTGGCAGTCGGTGCTTTGCATAGTAGAGGATCCAGTGACGCCGACCAAGGGCAGCCTTCGTGAAGCTCTCGAAAGCTCTCGAAGCTGGTGGACTCCGAAACATTGTAGAGGTGCCGCAGTCCAAACTACCGGGCTTGGGTGCACTACAGACACCGGAATTGCCTTGTGCCGATGATTCGGCCGATGTGATGATCCTCCGATGATCCTCCCCAAAACATAGACAACATAGACATAGTTGCCGACCTTGCGTACGCTTATACTACCAGTGATTTTACGGCCGCAAGTTTGACTTCTTCAAAGTATGGAATTTCTGTCCTCGGCCA

Full Affymetrix probeset data:

Annotations for 1639251_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime