FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639253_at:

>probe:Drosophila_2:1639253_at:517:65; Interrogation_Position=1100; Antisense; ATGGTGTTCTCAATCATTTTGCATT
>probe:Drosophila_2:1639253_at:722:263; Interrogation_Position=618; Antisense; CAGATGTGAGGTTACGGTTCCAGGT
>probe:Drosophila_2:1639253_at:538:537; Interrogation_Position=633; Antisense; GGTTCCAGGTAATCCAACACGACGA
>probe:Drosophila_2:1639253_at:545:235; Interrogation_Position=663; Antisense; AATCCGATACAATGGTCCGCTCGAA
>probe:Drosophila_2:1639253_at:594:583; Interrogation_Position=756; Antisense; TGGAAAGGCCTACTTTACGTGTGCC
>probe:Drosophila_2:1639253_at:531:705; Interrogation_Position=770; Antisense; TTACGTGTGCCCCAAATTACGGCGG
>probe:Drosophila_2:1639253_at:661:245; Interrogation_Position=784; Antisense; AATTACGGCGGCTTTGTATCACCAT
>probe:Drosophila_2:1639253_at:32:471; Interrogation_Position=799; Antisense; GTATCACCATTATCCGTTACGGTTG
>probe:Drosophila_2:1639253_at:458:693; Interrogation_Position=829; Antisense; TTTCCGCCGGAAGACTTCAACATGG
>probe:Drosophila_2:1639253_at:433:255; Interrogation_Position=846; Antisense; CAACATGGATGACGAGCTCTGAGAA
>probe:Drosophila_2:1639253_at:417:337; Interrogation_Position=861; Antisense; GCTCTGAGAATACTGGGCACTCCCA
>probe:Drosophila_2:1639253_at:609:157; Interrogation_Position=887; Antisense; ACACAGGTCACACAATCTCGCATCG
>probe:Drosophila_2:1639253_at:194:43; Interrogation_Position=908; Antisense; ATCGCACATGCCACCTTAAACAGAA
>probe:Drosophila_2:1639253_at:430:381; Interrogation_Position=940; Antisense; GAACCGCTAAAACTATTTGTACGCA

Paste this into a BLAST search page for me
ATGGTGTTCTCAATCATTTTGCATTCAGATGTGAGGTTACGGTTCCAGGTGGTTCCAGGTAATCCAACACGACGAAATCCGATACAATGGTCCGCTCGAATGGAAAGGCCTACTTTACGTGTGCCTTACGTGTGCCCCAAATTACGGCGGAATTACGGCGGCTTTGTATCACCATGTATCACCATTATCCGTTACGGTTGTTTCCGCCGGAAGACTTCAACATGGCAACATGGATGACGAGCTCTGAGAAGCTCTGAGAATACTGGGCACTCCCAACACAGGTCACACAATCTCGCATCGATCGCACATGCCACCTTAAACAGAAGAACCGCTAAAACTATTTGTACGCA

Full Affymetrix probeset data:

Annotations for 1639253_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720