FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639254_at:

>probe:Drosophila_2:1639254_at:729:447; Interrogation_Position=178; Antisense; GATGCCAAAGCTGGGCTGTTTCTCA
>probe:Drosophila_2:1639254_at:489:593; Interrogation_Position=189; Antisense; TGGGCTGTTTCTCATTTTGGCTAAT
>probe:Drosophila_2:1639254_at:600:655; Interrogation_Position=210; Antisense; TAATGTTCGTTGTCGGAGCCGCGGT
>probe:Drosophila_2:1639254_at:326:297; Interrogation_Position=229; Antisense; CGCGGTGGCCATCGAAGTTCAGAAA
>probe:Drosophila_2:1639254_at:445:561; Interrogation_Position=283; Antisense; GGAACACCCGCAGCATCACGAGAAG
>probe:Drosophila_2:1639254_at:25:213; Interrogation_Position=323; Antisense; AAGATACCTGGAGTTCCGGGCGTTG
>probe:Drosophila_2:1639254_at:187:439; Interrogation_Position=340; Antisense; GGGCGTTGATTATCCGATTTACCAC
>probe:Drosophila_2:1639254_at:491:713; Interrogation_Position=383; Antisense; TTCAGTTGCCACAATGTGCCGGCCA
>probe:Drosophila_2:1639254_at:566:259; Interrogation_Position=452; Antisense; CACGTGTGCCACGATGGACGCGAAG
>probe:Drosophila_2:1639254_at:206:81; Interrogation_Position=483; Antisense; AGGGCGCCAAGTTCCTATGCACCAA
>probe:Drosophila_2:1639254_at:322:247; Interrogation_Position=531; Antisense; AATTCGCCTGCGATTGGTGGTACAA
>probe:Drosophila_2:1639254_at:556:517; Interrogation_Position=562; Antisense; GTGTGAGGAGGCTACCCACTTTTAC
>probe:Drosophila_2:1639254_at:99:147; Interrogation_Position=579; Antisense; ACTTTTACCACTTGAATGCCGATCC
>probe:Drosophila_2:1639254_at:654:173; Interrogation_Position=632; Antisense; AAACCTGAGCTGGAACCTTATGCAA

Paste this into a BLAST search page for me
GATGCCAAAGCTGGGCTGTTTCTCATGGGCTGTTTCTCATTTTGGCTAATTAATGTTCGTTGTCGGAGCCGCGGTCGCGGTGGCCATCGAAGTTCAGAAAGGAACACCCGCAGCATCACGAGAAGAAGATACCTGGAGTTCCGGGCGTTGGGGCGTTGATTATCCGATTTACCACTTCAGTTGCCACAATGTGCCGGCCACACGTGTGCCACGATGGACGCGAAGAGGGCGCCAAGTTCCTATGCACCAAAATTCGCCTGCGATTGGTGGTACAAGTGTGAGGAGGCTACCCACTTTTACACTTTTACCACTTGAATGCCGATCCAAACCTGAGCTGGAACCTTATGCAA

Full Affymetrix probeset data:

Annotations for 1639254_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720