FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639256_at:

>probe:Drosophila_2:1639256_at:83:681; Interrogation_Position=203; Antisense; TAGGCAAATTTGCTGCCTTTGCAGT
>probe:Drosophila_2:1639256_at:28:317; Interrogation_Position=217; Antisense; GCCTTTGCAGTTGGCGGCAGCATAA
>probe:Drosophila_2:1639256_at:657:345; Interrogation_Position=236; Antisense; GCATAATCTTGCTCGAAATCGCCCA
>probe:Drosophila_2:1639256_at:457:45; Interrogation_Position=253; Antisense; ATCGCCCACCAAGAAGGACTTATAA
>probe:Drosophila_2:1639256_at:379:633; Interrogation_Position=317; Antisense; TCGCCGATAAAGTGGAAGCCTCGCT
>probe:Drosophila_2:1639256_at:294:205; Interrogation_Position=332; Antisense; AAGCCTCGCTGGGTCGTGAGAAGAA
>probe:Drosophila_2:1639256_at:632:99; Interrogation_Position=400; Antisense; AGAGCTGAAAGCCTCCTAACCCGAA
>probe:Drosophila_2:1639256_at:403:435; Interrogation_Position=472; Antisense; GAGGGTCCAAAAGTCAACGATCTGC
>probe:Drosophila_2:1639256_at:486:687; Interrogation_Position=500; Antisense; TATTTTTGGCATCATTTTTCGGTGG
>probe:Drosophila_2:1639256_at:611:625; Interrogation_Position=528; Antisense; TGCCCTGGGCATTGCTACTGGATAA
>probe:Drosophila_2:1639256_at:207:211; Interrogation_Position=553; Antisense; AAGAATTTTCCGATTGGCACAACAA
>probe:Drosophila_2:1639256_at:157:541; Interrogation_Position=660; Antisense; GGTTCTTTCCCAAAACATCTCAACA
>probe:Drosophila_2:1639256_at:604:37; Interrogation_Position=676; Antisense; ATCTCAACACTCTTCGGGTTTTCGA
>probe:Drosophila_2:1639256_at:328:277; Interrogation_Position=732; Antisense; CTTATTTTACAGTCCATTTCGTTGA

Paste this into a BLAST search page for me
TAGGCAAATTTGCTGCCTTTGCAGTGCCTTTGCAGTTGGCGGCAGCATAAGCATAATCTTGCTCGAAATCGCCCAATCGCCCACCAAGAAGGACTTATAATCGCCGATAAAGTGGAAGCCTCGCTAAGCCTCGCTGGGTCGTGAGAAGAAAGAGCTGAAAGCCTCCTAACCCGAAGAGGGTCCAAAAGTCAACGATCTGCTATTTTTGGCATCATTTTTCGGTGGTGCCCTGGGCATTGCTACTGGATAAAAGAATTTTCCGATTGGCACAACAAGGTTCTTTCCCAAAACATCTCAACAATCTCAACACTCTTCGGGTTTTCGACTTATTTTACAGTCCATTTCGTTGA

Full Affymetrix probeset data:

Annotations for 1639256_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720