Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639257_s_at:

>probe:Drosophila_2:1639257_s_at:272:223; Interrogation_Position=1039; Antisense; AAGGGACTGTGAGGCCCTATGCCAT
>probe:Drosophila_2:1639257_s_at:196:577; Interrogation_Position=1051; Antisense; GGCCCTATGCCATTTACGAGCTTAA
>probe:Drosophila_2:1639257_s_at:39:193; Interrogation_Position=1101; Antisense; AACTATTTATTTCCCTTCTTGCATT
>probe:Drosophila_2:1639257_s_at:128:695; Interrogation_Position=1135; Antisense; TTTGCCTGTTGACTTCTGTTCGAAA
>probe:Drosophila_2:1639257_s_at:566:29; Interrogation_Position=1159; Antisense; ATACTCCTGATATTAGCCTGACCGC
>probe:Drosophila_2:1639257_s_at:18:611; Interrogation_Position=1177; Antisense; TGACCGCATATGCTTACCGTTCACA
>probe:Drosophila_2:1639257_s_at:626:225; Interrogation_Position=739; Antisense; AAGGCGGCCGTTGTTGGGATCTCAA
>probe:Drosophila_2:1639257_s_at:259:451; Interrogation_Position=756; Antisense; GATCTCAACCGTAATCCTAAGTCGA
>probe:Drosophila_2:1639257_s_at:59:237; Interrogation_Position=780; Antisense; AATCGCCATGGCCATACCGGGAATG
>probe:Drosophila_2:1639257_s_at:120:131; Interrogation_Position=813; Antisense; ACCGGTGTTGATGAATGTCCTCGAA
>probe:Drosophila_2:1639257_s_at:321:543; Interrogation_Position=844; Antisense; GGATTCCTGGCTAAATACCCGCGAT
>probe:Drosophila_2:1639257_s_at:304:623; Interrogation_Position=895; Antisense; TGCGGCTTCGTGCTGATTTTCGCCA
>probe:Drosophila_2:1639257_s_at:650:315; Interrogation_Position=934; Antisense; GCCTTCTTCAAGCAGCGAGCGGACA
>probe:Drosophila_2:1639257_s_at:112:641; Interrogation_Position=979; Antisense; TCGGAGGTCCGCGACAGCATTAGGA

Paste this into a BLAST search page for me
AAGGGACTGTGAGGCCCTATGCCATGGCCCTATGCCATTTACGAGCTTAAAACTATTTATTTCCCTTCTTGCATTTTTGCCTGTTGACTTCTGTTCGAAAATACTCCTGATATTAGCCTGACCGCTGACCGCATATGCTTACCGTTCACAAAGGCGGCCGTTGTTGGGATCTCAAGATCTCAACCGTAATCCTAAGTCGAAATCGCCATGGCCATACCGGGAATGACCGGTGTTGATGAATGTCCTCGAAGGATTCCTGGCTAAATACCCGCGATTGCGGCTTCGTGCTGATTTTCGCCAGCCTTCTTCAAGCAGCGAGCGGACATCGGAGGTCCGCGACAGCATTAGGA

Full Affymetrix probeset data:

Annotations for 1639257_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime