FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639259_at:

>probe:Drosophila_2:1639259_at:59:361; Interrogation_Position=1455; Antisense; GAATACGGGCGTGCGAAAGTCCAGA
>probe:Drosophila_2:1639259_at:595:217; Interrogation_Position=1471; Antisense; AAGTCCAGAAATCCACTCTTCAATC
>probe:Drosophila_2:1639259_at:641:145; Interrogation_Position=1485; Antisense; ACTCTTCAATCCTGGTCACATTTTT
>probe:Drosophila_2:1639259_at:428:213; Interrogation_Position=1552; Antisense; AAGATGCAGCTTTCGGAGCACGTGC
>probe:Drosophila_2:1639259_at:276:619; Interrogation_Position=1603; Antisense; TGCATTGAACTGTCGGTGGCGCGTC
>probe:Drosophila_2:1639259_at:453:69; Interrogation_Position=1633; Antisense; ATGGCCGTGGAGCTGATGTTCACCA
>probe:Drosophila_2:1639259_at:663:59; Interrogation_Position=1648; Antisense; ATGTTCACCAAGCACGGCAACGCGG
>probe:Drosophila_2:1639259_at:62:703; Interrogation_Position=1721; Antisense; TTATCTATGCCATGTGGGCCAGCGT
>probe:Drosophila_2:1639259_at:459:81; Interrogation_Position=1750; Antisense; AGGGCATCCCGATCGTATTGCATTG
>probe:Drosophila_2:1639259_at:6:7; Interrogation_Position=1766; Antisense; ATTGCATTGGACTGCCGCTGGCGGA
>probe:Drosophila_2:1639259_at:179:583; Interrogation_Position=1784; Antisense; TGGCGGATCATGAACTGCTCACGGC
>probe:Drosophila_2:1639259_at:390:617; Interrogation_Position=1852; Antisense; TGCACGGAGATCTATGGCGGTCATT
>probe:Drosophila_2:1639259_at:54:591; Interrogation_Position=1898; Antisense; TGGTGCGACTCTCCAAGCAAGTGGC
>probe:Drosophila_2:1639259_at:148:335; Interrogation_Position=1942; Antisense; GCTGTTCATCCGCTGACATTTAACT

Paste this into a BLAST search page for me
GAATACGGGCGTGCGAAAGTCCAGAAAGTCCAGAAATCCACTCTTCAATCACTCTTCAATCCTGGTCACATTTTTAAGATGCAGCTTTCGGAGCACGTGCTGCATTGAACTGTCGGTGGCGCGTCATGGCCGTGGAGCTGATGTTCACCAATGTTCACCAAGCACGGCAACGCGGTTATCTATGCCATGTGGGCCAGCGTAGGGCATCCCGATCGTATTGCATTGATTGCATTGGACTGCCGCTGGCGGATGGCGGATCATGAACTGCTCACGGCTGCACGGAGATCTATGGCGGTCATTTGGTGCGACTCTCCAAGCAAGTGGCGCTGTTCATCCGCTGACATTTAACT

Full Affymetrix probeset data:

Annotations for 1639259_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720