Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639262_at:

>probe:Drosophila_2:1639262_at:418:119; Interrogation_Position=1941; Antisense; AGCTGCCTGCAACTCGAATTCGGAC
>probe:Drosophila_2:1639262_at:625:557; Interrogation_Position=1962; Antisense; GGACATCTACGAGCAGTTCACACGT
>probe:Drosophila_2:1639262_at:372:357; Interrogation_Position=1997; Antisense; GAACTCCCTTCCAGTGGACGAATGG
>probe:Drosophila_2:1639262_at:282:619; Interrogation_Position=2043; Antisense; TGCATCCAAGACATGGTTGCCACTG
>probe:Drosophila_2:1639262_at:65:573; Interrogation_Position=2109; Antisense; GGCTCAGCGCTCTCATCTGAAAATC
>probe:Drosophila_2:1639262_at:475:37; Interrogation_Position=2131; Antisense; ATCTATAAGGCGCTGGTGGAACTGA
>probe:Drosophila_2:1639262_at:136:195; Interrogation_Position=2150; Antisense; AACTGAGGAAATCGTCGCTTCCGCT
>probe:Drosophila_2:1639262_at:355:595; Interrogation_Position=2220; Antisense; TGTGGTGAAGCGTTACATCTCCGGC
>probe:Drosophila_2:1639262_at:484:631; Interrogation_Position=2239; Antisense; TCCGGCTCTGCATCCATAATTTATG
>probe:Drosophila_2:1639262_at:490:147; Interrogation_Position=2270; Antisense; ACTTTGCCAGCAAGGGTGTCACTGT
>probe:Drosophila_2:1639262_at:152:29; Interrogation_Position=2301; Antisense; ATACGAATTCGACAAGACGCTGCCC
>probe:Drosophila_2:1639262_at:260:573; Interrogation_Position=2374; Antisense; GGCTCTCAGTTCGAGGTGACCGGAT
>probe:Drosophila_2:1639262_at:634:439; Interrogation_Position=2416; Antisense; GAGGCCTTGGTATTGAGCAGCAGCA
>probe:Drosophila_2:1639262_at:289:351; Interrogation_Position=2435; Antisense; GCAGCAGTTCTTCCCGGTTCGATTA

Paste this into a BLAST search page for me
AGCTGCCTGCAACTCGAATTCGGACGGACATCTACGAGCAGTTCACACGTGAACTCCCTTCCAGTGGACGAATGGTGCATCCAAGACATGGTTGCCACTGGGCTCAGCGCTCTCATCTGAAAATCATCTATAAGGCGCTGGTGGAACTGAAACTGAGGAAATCGTCGCTTCCGCTTGTGGTGAAGCGTTACATCTCCGGCTCCGGCTCTGCATCCATAATTTATGACTTTGCCAGCAAGGGTGTCACTGTATACGAATTCGACAAGACGCTGCCCGGCTCTCAGTTCGAGGTGACCGGATGAGGCCTTGGTATTGAGCAGCAGCAGCAGCAGTTCTTCCCGGTTCGATTA

Full Affymetrix probeset data:

Annotations for 1639262_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime