Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639264_at:

>probe:Drosophila_2:1639264_at:698:413; Interrogation_Position=1893; Antisense; GACCAATTACGTTCATCGCATCGGA
>probe:Drosophila_2:1639264_at:669:331; Interrogation_Position=2012; Antisense; GCGGCCGTAGCTGCAACAACACAAA
>probe:Drosophila_2:1639264_at:700:659; Interrogation_Position=2039; Antisense; TAACCGAAGTCCGAGGATGCTGCAT
>probe:Drosophila_2:1639264_at:705:545; Interrogation_Position=2053; Antisense; GGATGCTGCATCTGGTACAACGAAC
>probe:Drosophila_2:1639264_at:4:377; Interrogation_Position=2074; Antisense; GAACCAAACCTACTGGCCGAAGTTG
>probe:Drosophila_2:1639264_at:610:607; Interrogation_Position=2097; Antisense; TGAGGACCACTTGAACATCACCATC
>probe:Drosophila_2:1639264_at:609:441; Interrogation_Position=2143; Antisense; GATGTGCCAGTTAATGACTTCGACG
>probe:Drosophila_2:1639264_at:309:407; Interrogation_Position=2164; Antisense; GACGGCAAGGTCGTGTACGGTCAAA
>probe:Drosophila_2:1639264_at:565:195; Interrogation_Position=2199; Antisense; AACTGGCAGCGGCTACGAAGACCAC
>probe:Drosophila_2:1639264_at:253:353; Interrogation_Position=2229; Antisense; GCAGCTGGTGCCAACTGTACGCAAA
>probe:Drosophila_2:1639264_at:708:641; Interrogation_Position=2298; Antisense; TCTTAAGGTCTAACGCGGATCTGGA
>probe:Drosophila_2:1639264_at:664:553; Interrogation_Position=2320; Antisense; GGAGCGACATTTGTTTGCTATGCAA
>probe:Drosophila_2:1639264_at:196:511; Interrogation_Position=2369; Antisense; GTGCAAGACCAACTCACGCGGAAAT
>probe:Drosophila_2:1639264_at:278:501; Interrogation_Position=2434; Antisense; GTCGGAGCTCAAGCTCTGCTATTAA

Paste this into a BLAST search page for me
GACCAATTACGTTCATCGCATCGGAGCGGCCGTAGCTGCAACAACACAAATAACCGAAGTCCGAGGATGCTGCATGGATGCTGCATCTGGTACAACGAACGAACCAAACCTACTGGCCGAAGTTGTGAGGACCACTTGAACATCACCATCGATGTGCCAGTTAATGACTTCGACGGACGGCAAGGTCGTGTACGGTCAAAAACTGGCAGCGGCTACGAAGACCACGCAGCTGGTGCCAACTGTACGCAAATCTTAAGGTCTAACGCGGATCTGGAGGAGCGACATTTGTTTGCTATGCAAGTGCAAGACCAACTCACGCGGAAATGTCGGAGCTCAAGCTCTGCTATTAA

Full Affymetrix probeset data:

Annotations for 1639264_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime