FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639265_at:

>probe:Drosophila_2:1639265_at:50:213; Interrogation_Position=102; Antisense; AAGACTTCAGAGAGACGATTCCGCT
>probe:Drosophila_2:1639265_at:580:293; Interrogation_Position=117; Antisense; CGATTCCGCTGCAAATACACCAAAA
>probe:Drosophila_2:1639265_at:182:45; Interrogation_Position=177; Antisense; ATCGCTGAGCTCTCGCAGGATAGGA
>probe:Drosophila_2:1639265_at:584:107; Interrogation_Position=233; Antisense; AGAAGCTAGAGTTTGCTGCGGCCCA
>probe:Drosophila_2:1639265_at:379:621; Interrogation_Position=246; Antisense; TGCTGCGGCCCACGGAATTAAGGAC
>probe:Drosophila_2:1639265_at:72:161; Interrogation_Position=27; Antisense; AAATAACACGCCTCAATCCGGACGG
>probe:Drosophila_2:1639265_at:716:251; Interrogation_Position=331; Antisense; CAAGAGGCTCTTGATGCGCCAGAGG
>probe:Drosophila_2:1639265_at:11:381; Interrogation_Position=381; Antisense; GAACCAGCTTGAAAACAGTCCACAG
>probe:Drosophila_2:1639265_at:79:287; Interrogation_Position=444; Antisense; CTGGCGGCAGGGATTCAAAGCTTCT
>probe:Drosophila_2:1639265_at:589:205; Interrogation_Position=461; Antisense; AAGCTTCTGTGGGTGACCTACTAAC
>probe:Drosophila_2:1639265_at:289:413; Interrogation_Position=475; Antisense; GACCTACTAACTATGGCGGAGCCAG
>probe:Drosophila_2:1639265_at:347:547; Interrogation_Position=50; Antisense; GGAGACCCCGACTCGGATTGAGTAG
>probe:Drosophila_2:1639265_at:216:109; Interrogation_Position=508; Antisense; AGAAGCGATCTCCTTACTCGGCTGG
>probe:Drosophila_2:1639265_at:15:471; Interrogation_Position=80; Antisense; GTTGCCAGTCAACGCCCTTAATAAG

Paste this into a BLAST search page for me
AAGACTTCAGAGAGACGATTCCGCTCGATTCCGCTGCAAATACACCAAAAATCGCTGAGCTCTCGCAGGATAGGAAGAAGCTAGAGTTTGCTGCGGCCCATGCTGCGGCCCACGGAATTAAGGACAAATAACACGCCTCAATCCGGACGGCAAGAGGCTCTTGATGCGCCAGAGGGAACCAGCTTGAAAACAGTCCACAGCTGGCGGCAGGGATTCAAAGCTTCTAAGCTTCTGTGGGTGACCTACTAACGACCTACTAACTATGGCGGAGCCAGGGAGACCCCGACTCGGATTGAGTAGAGAAGCGATCTCCTTACTCGGCTGGGTTGCCAGTCAACGCCCTTAATAAG

Full Affymetrix probeset data:

Annotations for 1639265_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720