FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639266_at:

>probe:Drosophila_2:1639266_at:464:649; Interrogation_Position=2319; Antisense; TCAGCCCAACCCTAGTTAGTTGTAT
>probe:Drosophila_2:1639266_at:500:99; Interrogation_Position=2380; Antisense; AGATGTATAACCTTACCATCCCGCA
>probe:Drosophila_2:1639266_at:213:215; Interrogation_Position=2431; Antisense; AAGATTAAACGTGCCAGTCCCAAAG
>probe:Drosophila_2:1639266_at:395:505; Interrogation_Position=2441; Antisense; GTGCCAGTCCCAAAGTATTTTAGTA
>probe:Drosophila_2:1639266_at:547:89; Interrogation_Position=2462; Antisense; AGTACCAAGATGTGTACCCAACCCA
>probe:Drosophila_2:1639266_at:169:611; Interrogation_Position=2488; Antisense; TGACCCTCGCCAATATGCATATGTA
>probe:Drosophila_2:1639266_at:274:571; Interrogation_Position=2550; Antisense; GGCTTATATCTTAAGTTTCGCCCAC
>probe:Drosophila_2:1639266_at:157:693; Interrogation_Position=2565; Antisense; TTTCGCCCACTTAAAACCTAGCCAG
>probe:Drosophila_2:1639266_at:80:131; Interrogation_Position=2580; Antisense; ACCTAGCCAGCTAACTGAACTTGTA
>probe:Drosophila_2:1639266_at:541:225; Interrogation_Position=2613; Antisense; AAGGACTCCCTATTTATTATGACTA
>probe:Drosophila_2:1639266_at:225:187; Interrogation_Position=2658; Antisense; AACAAATCTCACACTCACCGGAGAA
>probe:Drosophila_2:1639266_at:152:389; Interrogation_Position=2680; Antisense; GAAAACTTCATCCAACCAGATGGTC
>probe:Drosophila_2:1639266_at:59:539; Interrogation_Position=2701; Antisense; GGTCAATCGATCATTTATATCCACA
>probe:Drosophila_2:1639266_at:539:169; Interrogation_Position=2760; Antisense; AAAGTCCTACACTCATTTGATAAGT

Paste this into a BLAST search page for me
TCAGCCCAACCCTAGTTAGTTGTATAGATGTATAACCTTACCATCCCGCAAAGATTAAACGTGCCAGTCCCAAAGGTGCCAGTCCCAAAGTATTTTAGTAAGTACCAAGATGTGTACCCAACCCATGACCCTCGCCAATATGCATATGTAGGCTTATATCTTAAGTTTCGCCCACTTTCGCCCACTTAAAACCTAGCCAGACCTAGCCAGCTAACTGAACTTGTAAAGGACTCCCTATTTATTATGACTAAACAAATCTCACACTCACCGGAGAAGAAAACTTCATCCAACCAGATGGTCGGTCAATCGATCATTTATATCCACAAAAGTCCTACACTCATTTGATAAGT

Full Affymetrix probeset data:

Annotations for 1639266_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720