FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639267_at:

>probe:Drosophila_2:1639267_at:352:225; Interrogation_Position=105; Antisense; AAGGACCTTGCGCTGACTTTGACTT
>probe:Drosophila_2:1639267_at:489:505; Interrogation_Position=142; Antisense; GTCCATATCTGCAACGTCGATCAAT
>probe:Drosophila_2:1639267_at:129:19; Interrogation_Position=171; Antisense; ATTTCTGAGCTGATCAAACTGGCCA
>probe:Drosophila_2:1639267_at:47:179; Interrogation_Position=186; Antisense; AAACTGGCCAAGAGCAGCAGCGTCA
>probe:Drosophila_2:1639267_at:531:331; Interrogation_Position=232; Antisense; GCGGCAGCGGCTCAAGAATTATTAT
>probe:Drosophila_2:1639267_at:110:241; Interrogation_Position=270; Antisense; AATAATATTCGCAACCGCTGCAGCG
>probe:Drosophila_2:1639267_at:557:281; Interrogation_Position=319; Antisense; CTCGTCTGGACAGTCTGCTGATTAA
>probe:Drosophila_2:1639267_at:613:289; Interrogation_Position=371; Antisense; CGGAGATGGCCTGCGGTGCTTAAAA
>probe:Drosophila_2:1639267_at:336:29; Interrogation_Position=40; Antisense; ATACTAATTCAGTCGAGCTGGCAAG
>probe:Drosophila_2:1639267_at:58:439; Interrogation_Position=401; Antisense; GAGGCATCTGTCAAGTCGAGCGAAG
>probe:Drosophila_2:1639267_at:318:555; Interrogation_Position=451; Antisense; GGACCTGGCCTGCAGATCTGAAGAT
>probe:Drosophila_2:1639267_at:65:535; Interrogation_Position=64; Antisense; GGTGAACAAGAACTGCTTTCTCTTA
>probe:Drosophila_2:1639267_at:86:343; Interrogation_Position=78; Antisense; GCTTTCTCTTACATTTTTCTCTCAG
>probe:Drosophila_2:1639267_at:671:695; Interrogation_Position=93; Antisense; TTTCTCTCAGTGAAGGACCTTGCGC

Paste this into a BLAST search page for me
AAGGACCTTGCGCTGACTTTGACTTGTCCATATCTGCAACGTCGATCAATATTTCTGAGCTGATCAAACTGGCCAAAACTGGCCAAGAGCAGCAGCGTCAGCGGCAGCGGCTCAAGAATTATTATAATAATATTCGCAACCGCTGCAGCGCTCGTCTGGACAGTCTGCTGATTAACGGAGATGGCCTGCGGTGCTTAAAAATACTAATTCAGTCGAGCTGGCAAGGAGGCATCTGTCAAGTCGAGCGAAGGGACCTGGCCTGCAGATCTGAAGATGGTGAACAAGAACTGCTTTCTCTTAGCTTTCTCTTACATTTTTCTCTCAGTTTCTCTCAGTGAAGGACCTTGCGC

Full Affymetrix probeset data:

Annotations for 1639267_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720