FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639268_at:

>probe:Drosophila_2:1639268_at:609:643; Interrogation_Position=113; Antisense; TCTCACGCACCAGGGAAGTTCGCAA
>probe:Drosophila_2:1639268_at:405:135; Interrogation_Position=117; Antisense; ACGCACCAGGGAAGTTCGCAATCCG
>probe:Drosophila_2:1639268_at:518:511; Interrogation_Position=163; Antisense; GTGAACGTGAACTACCCCAATGGAT
>probe:Drosophila_2:1639268_at:111:383; Interrogation_Position=165; Antisense; GAACGTGAACTACCCCAATGGATTC
>probe:Drosophila_2:1639268_at:397:511; Interrogation_Position=169; Antisense; GTGAACTACCCCAATGGATTCTACA
>probe:Drosophila_2:1639268_at:325:277; Interrogation_Position=174; Antisense; CTACCCCAATGGATTCTACAACATC
>probe:Drosophila_2:1639268_at:455:191; Interrogation_Position=220; Antisense; AACTTCAAGAACAACTCTGGAGCAT
>probe:Drosophila_2:1639268_at:497:249; Interrogation_Position=225; Antisense; CAAGAACAACTCTGGAGCATCTCCT
>probe:Drosophila_2:1639268_at:516:533; Interrogation_Position=343; Antisense; GGTCGTTAAGTGATCTTTGGGAGCA
>probe:Drosophila_2:1639268_at:172:83; Interrogation_Position=351; Antisense; AGTGATCTTTGGGAGCATGTTGTAA
>probe:Drosophila_2:1639268_at:414:37; Interrogation_Position=355; Antisense; ATCTTTGGGAGCATGTTGTAAACGA
>probe:Drosophila_2:1639268_at:601:113; Interrogation_Position=364; Antisense; AGCATGTTGTAAACGAATTGAAGTC
>probe:Drosophila_2:1639268_at:106:373; Interrogation_Position=383; Antisense; GAAGTCGAATATGAAATGGCAAACA
>probe:Drosophila_2:1639268_at:479:391; Interrogation_Position=441; Antisense; GAAAGCAAAACTATGGAATCAATCA

Paste this into a BLAST search page for me
TCTCACGCACCAGGGAAGTTCGCAAACGCACCAGGGAAGTTCGCAATCCGGTGAACGTGAACTACCCCAATGGATGAACGTGAACTACCCCAATGGATTCGTGAACTACCCCAATGGATTCTACACTACCCCAATGGATTCTACAACATCAACTTCAAGAACAACTCTGGAGCATCAAGAACAACTCTGGAGCATCTCCTGGTCGTTAAGTGATCTTTGGGAGCAAGTGATCTTTGGGAGCATGTTGTAAATCTTTGGGAGCATGTTGTAAACGAAGCATGTTGTAAACGAATTGAAGTCGAAGTCGAATATGAAATGGCAAACAGAAAGCAAAACTATGGAATCAATCA

Full Affymetrix probeset data:

Annotations for 1639268_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720