Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639269_a_at:

>probe:Drosophila_2:1639269_a_at:438:145; Interrogation_Position=383; Antisense; ACTCTGTTGGTAAATCTCGGTGGAA
>probe:Drosophila_2:1639269_a_at:20:159; Interrogation_Position=419; Antisense; ACACTGAGTGCATTGCCCTACATGG
>probe:Drosophila_2:1639269_a_at:573:517; Interrogation_Position=494; Antisense; GTGGGTCTGGATCCAATGTTCATCA
>probe:Drosophila_2:1639269_a_at:462:59; Interrogation_Position=509; Antisense; ATGTTCATCATTCCCGTTTACGGAG
>probe:Drosophila_2:1639269_a_at:157:127; Interrogation_Position=536; Antisense; ACCAAGGCTGGCATCATCAACTTCA
>probe:Drosophila_2:1639269_a_at:557:649; Interrogation_Position=558; Antisense; TCACCCGGTGCTTGGCGAACGAAAA
>probe:Drosophila_2:1639269_a_at:479:183; Interrogation_Position=579; Antisense; AAAAGTACTATCAACGCTCGGGCAT
>probe:Drosophila_2:1639269_a_at:600:199; Interrogation_Position=591; Antisense; AACGCTCGGGCATCAAGTTTGTGAC
>probe:Drosophila_2:1639269_a_at:511:609; Interrogation_Position=612; Antisense; TGACTGTTTGTCCTGGAGCTACAAT
>probe:Drosophila_2:1639269_a_at:421:407; Interrogation_Position=637; Antisense; GACGGACATGTTCACCAACTTTACG
>probe:Drosophila_2:1639269_a_at:91:187; Interrogation_Position=719; Antisense; AACAAGCAGAGTGCCGCTGATGTCT
>probe:Drosophila_2:1639269_a_at:120:443; Interrogation_Position=737; Antisense; GATGTCTCTCGATGCATTCTGAATG
>probe:Drosophila_2:1639269_a_at:600:381; Interrogation_Position=778; Antisense; GAACGGAGCTGTCTATGTCATCGAG
>probe:Drosophila_2:1639269_a_at:498:517; Interrogation_Position=866; Antisense; GTGGGTTAATTCGTTCACATCCTAA

Paste this into a BLAST search page for me
ACTCTGTTGGTAAATCTCGGTGGAAACACTGAGTGCATTGCCCTACATGGGTGGGTCTGGATCCAATGTTCATCAATGTTCATCATTCCCGTTTACGGAGACCAAGGCTGGCATCATCAACTTCATCACCCGGTGCTTGGCGAACGAAAAAAAAGTACTATCAACGCTCGGGCATAACGCTCGGGCATCAAGTTTGTGACTGACTGTTTGTCCTGGAGCTACAATGACGGACATGTTCACCAACTTTACGAACAAGCAGAGTGCCGCTGATGTCTGATGTCTCTCGATGCATTCTGAATGGAACGGAGCTGTCTATGTCATCGAGGTGGGTTAATTCGTTCACATCCTAA

Full Affymetrix probeset data:

Annotations for 1639269_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime