FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639270_at:

>probe:Drosophila_2:1639270_at:153:521; Interrogation_Position=135; Antisense; GTGGCAACGGCCTCCTGAAGGTGAA
>probe:Drosophila_2:1639270_at:721:613; Interrogation_Position=156; Antisense; TGAACGGTCGTCCTCTGGAGCAGAT
>probe:Drosophila_2:1639270_at:557:239; Interrogation_Position=198; Antisense; AATACAAACTGCAGGAGCCCCTTCT
>probe:Drosophila_2:1639270_at:484:359; Interrogation_Position=231; Antisense; GCAAGGAGAAATTCGCCGGCGTCGA
>probe:Drosophila_2:1639270_at:491:517; Interrogation_Position=276; Antisense; GTGGTGGTCATGTAGCCCAGATCTA
>probe:Drosophila_2:1639270_at:454:643; Interrogation_Position=328; Antisense; TCTCGTTGCCTTCTACCAGAAATAC
>probe:Drosophila_2:1639270_at:18:455; Interrogation_Position=376; Antisense; GATCAAGGACATTCTGGTGCAGTAC
>probe:Drosophila_2:1639270_at:266:397; Interrogation_Position=401; Antisense; GACAGAACCCTGCTGGTCGGCGATC
>probe:Drosophila_2:1639270_at:288:411; Interrogation_Position=437; Antisense; GAGCCCAAGAAGTTCGGCGGTCCAG
>probe:Drosophila_2:1639270_at:519:371; Interrogation_Position=481; Antisense; GAAGTCGTACCGTTAAACTACTCTG
>probe:Drosophila_2:1639270_at:267:147; Interrogation_Position=497; Antisense; ACTACTCTGTCTGGTTTTCAATTTG
>probe:Drosophila_2:1639270_at:428:693; Interrogation_Position=543; Antisense; TTTGAAAATGGTTTGCACGCACGTG
>probe:Drosophila_2:1639270_at:68:379; Interrogation_Position=58; Antisense; GAAGCGCAGAGAACCCGTGCAGGCT
>probe:Drosophila_2:1639270_at:307:71; Interrogation_Position=78; Antisense; AGGCTGTCCAGGTCTTCGGACGCAA

Paste this into a BLAST search page for me
GTGGCAACGGCCTCCTGAAGGTGAATGAACGGTCGTCCTCTGGAGCAGATAATACAAACTGCAGGAGCCCCTTCTGCAAGGAGAAATTCGCCGGCGTCGAGTGGTGGTCATGTAGCCCAGATCTATCTCGTTGCCTTCTACCAGAAATACGATCAAGGACATTCTGGTGCAGTACGACAGAACCCTGCTGGTCGGCGATCGAGCCCAAGAAGTTCGGCGGTCCAGGAAGTCGTACCGTTAAACTACTCTGACTACTCTGTCTGGTTTTCAATTTGTTTGAAAATGGTTTGCACGCACGTGGAAGCGCAGAGAACCCGTGCAGGCTAGGCTGTCCAGGTCTTCGGACGCAA

Full Affymetrix probeset data:

Annotations for 1639270_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720