FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639275_at:

>probe:Drosophila_2:1639275_at:5:369; Interrogation_Position=2478; Antisense; GAATCCTCGAGAGCACAGACGAACT
>probe:Drosophila_2:1639275_at:11:265; Interrogation_Position=2493; Antisense; CAGACGAACTCGAACGGGCACAGTA
>probe:Drosophila_2:1639275_at:188:487; Interrogation_Position=2515; Antisense; GTAGCCACACAGTGTCGCTGGTCAA
>probe:Drosophila_2:1639275_at:139:59; Interrogation_Position=2550; Antisense; ATGATCCTGGAGGTCAGCACGCAAC
>probe:Drosophila_2:1639275_at:565:127; Interrogation_Position=2568; Antisense; ACGCAACCCAAGTCGGACGGGCAAT
>probe:Drosophila_2:1639275_at:114:189; Interrogation_Position=2596; Antisense; AATCCTCGACGAGCAGTCGCTTCGT
>probe:Drosophila_2:1639275_at:539:591; Interrogation_Position=2620; Antisense; TGGTGGTTGGTCGTCTCTTTCAGTC
>probe:Drosophila_2:1639275_at:424:633; Interrogation_Position=2643; Antisense; TCGCCAGCCAAGGAAGTGTACGTGT
>probe:Drosophila_2:1639275_at:197:219; Interrogation_Position=2656; Antisense; AAGTGTACGTGTGTCACCGGTCCGA
>probe:Drosophila_2:1639275_at:112:135; Interrogation_Position=2692; Antisense; ACATAGTCGAAATGGCCTTCCGGTT
>probe:Drosophila_2:1639275_at:604:465; Interrogation_Position=2714; Antisense; GTTGTCCTTCTTCTCAATGGGATGA
>probe:Drosophila_2:1639275_at:82:143; Interrogation_Position=2768; Antisense; ACTGGCTATGCGTAGAATTCTTGCT
>probe:Drosophila_2:1639275_at:181:325; Interrogation_Position=2972; Antisense; GCGCAAGCTTGCCAAAACTCTAAGA
>probe:Drosophila_2:1639275_at:3:491; Interrogation_Position=3010; Antisense; GTACATTTCCTCTGAAACGCAGCGA

Paste this into a BLAST search page for me
GAATCCTCGAGAGCACAGACGAACTCAGACGAACTCGAACGGGCACAGTAGTAGCCACACAGTGTCGCTGGTCAAATGATCCTGGAGGTCAGCACGCAACACGCAACCCAAGTCGGACGGGCAATAATCCTCGACGAGCAGTCGCTTCGTTGGTGGTTGGTCGTCTCTTTCAGTCTCGCCAGCCAAGGAAGTGTACGTGTAAGTGTACGTGTGTCACCGGTCCGAACATAGTCGAAATGGCCTTCCGGTTGTTGTCCTTCTTCTCAATGGGATGAACTGGCTATGCGTAGAATTCTTGCTGCGCAAGCTTGCCAAAACTCTAAGAGTACATTTCCTCTGAAACGCAGCGA

Full Affymetrix probeset data:

Annotations for 1639275_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720