FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639276_at:

>probe:Drosophila_2:1639276_at:490:577; Interrogation_Position=1189; Antisense; GGCGCCGGCAAGAATCATCCGATGT
>probe:Drosophila_2:1639276_at:103:603; Interrogation_Position=1211; Antisense; TGTTCAAGAGCATTGGCAACCCCAC
>probe:Drosophila_2:1639276_at:566:67; Interrogation_Position=1259; Antisense; ATGGCACCAGCAGCAATTCGGGCAT
>probe:Drosophila_2:1639276_at:311:493; Interrogation_Position=1346; Antisense; GTCAGAACTACTCGAAGACCTCGTC
>probe:Drosophila_2:1639276_at:599:101; Interrogation_Position=1361; Antisense; AGACCTCGTCGGCTAGTGCTTGGAA
>probe:Drosophila_2:1639276_at:529:725; Interrogation_Position=1396; Antisense; TTGACATGGCTAGACGATCTCACCC
>probe:Drosophila_2:1639276_at:464:237; Interrogation_Position=1424; Antisense; AATCGATCGGCGGTCCAGTGAGATA
>probe:Drosophila_2:1639276_at:467:483; Interrogation_Position=1452; Antisense; GTATCGAGCATGACCTAATCCCTTG
>probe:Drosophila_2:1639276_at:610:647; Interrogation_Position=1467; Antisense; TAATCCCTTGGAGCCTGTGACTAAG
>probe:Drosophila_2:1639276_at:144:171; Interrogation_Position=1499; Antisense; AAAGTGATTGCCACCTCATGCTAAT
>probe:Drosophila_2:1639276_at:200:27; Interrogation_Position=1531; Antisense; ATACCTCACCCTCTAATGGCGATGA
>probe:Drosophila_2:1639276_at:533:415; Interrogation_Position=1604; Antisense; GAGCCATACTGGGTGCAACGAGATG
>probe:Drosophila_2:1639276_at:41:607; Interrogation_Position=1633; Antisense; TGATCTGATCCCTGTTTCGCGATAA
>probe:Drosophila_2:1639276_at:479:31; Interrogation_Position=1660; Antisense; ATAACCAATCCCTATCAGTACAACT

Paste this into a BLAST search page for me
GGCGCCGGCAAGAATCATCCGATGTTGTTCAAGAGCATTGGCAACCCCACATGGCACCAGCAGCAATTCGGGCATGTCAGAACTACTCGAAGACCTCGTCAGACCTCGTCGGCTAGTGCTTGGAATTGACATGGCTAGACGATCTCACCCAATCGATCGGCGGTCCAGTGAGATAGTATCGAGCATGACCTAATCCCTTGTAATCCCTTGGAGCCTGTGACTAAGAAAGTGATTGCCACCTCATGCTAATATACCTCACCCTCTAATGGCGATGAGAGCCATACTGGGTGCAACGAGATGTGATCTGATCCCTGTTTCGCGATAAATAACCAATCCCTATCAGTACAACT

Full Affymetrix probeset data:

Annotations for 1639276_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720