FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639278_at:

>probe:Drosophila_2:1639278_at:315:381; Interrogation_Position=159; Antisense; GAACCTAAAGACCATTCCTCGCATA
>probe:Drosophila_2:1639278_at:327:199; Interrogation_Position=240; Antisense; AACGAGTCCAAGCAAGCGGCGCTTA
>probe:Drosophila_2:1639278_at:478:73; Interrogation_Position=293; Antisense; AGGAACTTAACGTGGTGCAGCCCGT
>probe:Drosophila_2:1639278_at:729:27; Interrogation_Position=326; Antisense; ATACGCTCCTTGAGCTGCTTGACAA
>probe:Drosophila_2:1639278_at:607:619; Interrogation_Position=341; Antisense; TGCTTGACAACAACGCTATTCCCAG
>probe:Drosophila_2:1639278_at:546:341; Interrogation_Position=355; Antisense; GCTATTCCCAGCGAGCAGGTGAAGT
>probe:Drosophila_2:1639278_at:374:115; Interrogation_Position=368; Antisense; AGCAGGTGAAGTTCGTCCACTGGAA
>probe:Drosophila_2:1639278_at:716:559; Interrogation_Position=389; Antisense; GGAAGGATTTCGATCGTGCCCTCCA
>probe:Drosophila_2:1639278_at:563:447; Interrogation_Position=418; Antisense; GATGCCGATCTGTACAGCAAGGTTA
>probe:Drosophila_2:1639278_at:515:213; Interrogation_Position=436; Antisense; AAGGTTATCCAGCTGGGACGCCGTC
>probe:Drosophila_2:1639278_at:149:209; Interrogation_Position=475; Antisense; AAGCAGACTCTCAGCTTTGGCAGCT
>probe:Drosophila_2:1639278_at:57:577; Interrogation_Position=514; Antisense; GGCGACGAGCAGAATCCGGACTTTA
>probe:Drosophila_2:1639278_at:218:139; Interrogation_Position=590; Antisense; ACGATCGCCAATTCCTCAAGTACAA
>probe:Drosophila_2:1639278_at:3:493; Interrogation_Position=682; Antisense; GTAACTTACCAACACTGCTAGCTAG

Paste this into a BLAST search page for me
GAACCTAAAGACCATTCCTCGCATAAACGAGTCCAAGCAAGCGGCGCTTAAGGAACTTAACGTGGTGCAGCCCGTATACGCTCCTTGAGCTGCTTGACAATGCTTGACAACAACGCTATTCCCAGGCTATTCCCAGCGAGCAGGTGAAGTAGCAGGTGAAGTTCGTCCACTGGAAGGAAGGATTTCGATCGTGCCCTCCAGATGCCGATCTGTACAGCAAGGTTAAAGGTTATCCAGCTGGGACGCCGTCAAGCAGACTCTCAGCTTTGGCAGCTGGCGACGAGCAGAATCCGGACTTTAACGATCGCCAATTCCTCAAGTACAAGTAACTTACCAACACTGCTAGCTAG

Full Affymetrix probeset data:

Annotations for 1639278_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720