Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639279_a_at:

>probe:Drosophila_2:1639279_a_at:351:635; Interrogation_Position=418; Antisense; TCGCCGGGATCTTATGGAGTTCTTC
>probe:Drosophila_2:1639279_a_at:273:419; Interrogation_Position=503; Antisense; GAGCTGCGTATCAAGTCCAACAAGG
>probe:Drosophila_2:1639279_a_at:440:653; Interrogation_Position=555; Antisense; TCAAGGAGCGCAACATGCTGCTGAC
>probe:Drosophila_2:1639279_a_at:193:229; Interrogation_Position=604; Antisense; AATGGAAGTCTTCCCTAGTCCGGAG
>probe:Drosophila_2:1639279_a_at:634:87; Interrogation_Position=620; Antisense; AGTCCGGAGCGCATCGATAAGGTGA
>probe:Drosophila_2:1639279_a_at:447:387; Interrogation_Position=685; Antisense; GAACAAGGCGTATCACCTGCTGGAA
>probe:Drosophila_2:1639279_a_at:277:611; Interrogation_Position=715; Antisense; TGAAACGGGTGAACGGCCCCAGAAG
>probe:Drosophila_2:1639279_a_at:199:377; Interrogation_Position=745; Antisense; GAAGAACGCATTTGGCCTGCAGGTC
>probe:Drosophila_2:1639279_a_at:355:729; Interrogation_Position=756; Antisense; TTGGCCTGCAGGTCTCATACAAAGC
>probe:Drosophila_2:1639279_a_at:418:299; Interrogation_Position=798; Antisense; CGCCCTTCATGAACCTCAAATGGAT
>probe:Drosophila_2:1639279_a_at:476:277; Interrogation_Position=841; Antisense; CTACGGCGGCAGAGCTGTGAACAGA
>probe:Drosophila_2:1639279_a_at:730:333; Interrogation_Position=854; Antisense; GCTGTGAACAGATTCCTCTTAAAGT
>probe:Drosophila_2:1639279_a_at:174:551; Interrogation_Position=883; Antisense; GGAGAAACTCTACAATGCCAAGCGC
>probe:Drosophila_2:1639279_a_at:217:337; Interrogation_Position=974; Antisense; GCTCCCGCAACGAAGTCATGATGAT

Paste this into a BLAST search page for me
TCGCCGGGATCTTATGGAGTTCTTCGAGCTGCGTATCAAGTCCAACAAGGTCAAGGAGCGCAACATGCTGCTGACAATGGAAGTCTTCCCTAGTCCGGAGAGTCCGGAGCGCATCGATAAGGTGAGAACAAGGCGTATCACCTGCTGGAATGAAACGGGTGAACGGCCCCAGAAGGAAGAACGCATTTGGCCTGCAGGTCTTGGCCTGCAGGTCTCATACAAAGCCGCCCTTCATGAACCTCAAATGGATCTACGGCGGCAGAGCTGTGAACAGAGCTGTGAACAGATTCCTCTTAAAGTGGAGAAACTCTACAATGCCAAGCGCGCTCCCGCAACGAAGTCATGATGAT

Full Affymetrix probeset data:

Annotations for 1639279_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime