FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639280_at:

>probe:Drosophila_2:1639280_at:545:401; Interrogation_Position=1472; Antisense; GACTTTTCTCCAAACGGATTCCACA
>probe:Drosophila_2:1639280_at:452:463; Interrogation_Position=1488; Antisense; GATTCCACATAGCAACAGGGTCCCA
>probe:Drosophila_2:1639280_at:656:163; Interrogation_Position=1527; Antisense; AAATCTGGGACCTGAGGCGACGCCA
>probe:Drosophila_2:1639280_at:609:623; Interrogation_Position=1570; Antisense; TGCGCACACCAATCTGATTTCGGAC
>probe:Drosophila_2:1639280_at:161:91; Interrogation_Position=1599; Antisense; AGTACCAGCAGGAGTGCGGCAGCTT
>probe:Drosophila_2:1639280_at:159:535; Interrogation_Position=1662; Antisense; GGTCCAACAAGACGTGGCAGCCGTT
>probe:Drosophila_2:1639280_at:421:617; Interrogation_Position=1695; Antisense; TGCAGGGCCACGACAACAAGGTCAT
>probe:Drosophila_2:1639280_at:462:79; Interrogation_Position=1713; Antisense; AGGTCATATCGGTGGACATCGCGCC
>probe:Drosophila_2:1639280_at:19:351; Interrogation_Position=1744; Antisense; GCAGTATATAGCCACGACCTCATTT
>probe:Drosophila_2:1639280_at:573:411; Interrogation_Position=1759; Antisense; GACCTCATTTGACCGCACATTTAAG
>probe:Drosophila_2:1639280_at:611:633; Interrogation_Position=1790; Antisense; TCGCCGGATAGCTGATTTTGATACC
>probe:Drosophila_2:1639280_at:594:143; Interrogation_Position=1818; Antisense; ACTTTATTGTACTCACCTGTGGGCG
>probe:Drosophila_2:1639280_at:624:595; Interrogation_Position=1835; Antisense; TGTGGGCGTACGCAGACAATCTCCA
>probe:Drosophila_2:1639280_at:15:355; Interrogation_Position=1879; Antisense; GCACGACTTACTCATCAACTGTTTT

Paste this into a BLAST search page for me
GACTTTTCTCCAAACGGATTCCACAGATTCCACATAGCAACAGGGTCCCAAAATCTGGGACCTGAGGCGACGCCATGCGCACACCAATCTGATTTCGGACAGTACCAGCAGGAGTGCGGCAGCTTGGTCCAACAAGACGTGGCAGCCGTTTGCAGGGCCACGACAACAAGGTCATAGGTCATATCGGTGGACATCGCGCCGCAGTATATAGCCACGACCTCATTTGACCTCATTTGACCGCACATTTAAGTCGCCGGATAGCTGATTTTGATACCACTTTATTGTACTCACCTGTGGGCGTGTGGGCGTACGCAGACAATCTCCAGCACGACTTACTCATCAACTGTTTT

Full Affymetrix probeset data:

Annotations for 1639280_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720