FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639281_at:

>probe:Drosophila_2:1639281_at:560:709; Interrogation_Position=316; Antisense; TTAATGTGCAACAGCCCCAGTGCCA
>probe:Drosophila_2:1639281_at:231:617; Interrogation_Position=390; Antisense; TGCAGGTGGTCCCAATCCTGGATAT
>probe:Drosophila_2:1639281_at:114:67; Interrogation_Position=413; Antisense; ATGGATCCGTGGGAGCTGCAACTGC
>probe:Drosophila_2:1639281_at:579:615; Interrogation_Position=429; Antisense; TGCAACTGCGTCCAGCTACAAAATG
>probe:Drosophila_2:1639281_at:548:225; Interrogation_Position=480; Antisense; AAGGAAACGCATCCAGAGGTCCGCC
>probe:Drosophila_2:1639281_at:281:319; Interrogation_Position=502; Antisense; GCCCCAACTGGTAGCATCAATTCGG
>probe:Drosophila_2:1639281_at:118:569; Interrogation_Position=525; Antisense; GGCTTTCGATGAGCTAAGGGTCCAT
>probe:Drosophila_2:1639281_at:202:609; Interrogation_Position=578; Antisense; TGAGCAAGATCGACACTCTGCGGCT
>probe:Drosophila_2:1639281_at:2:723; Interrogation_Position=602; Antisense; TTGCCATCGCCTATATATCTCTGCT
>probe:Drosophila_2:1639281_at:344:37; Interrogation_Position=618; Antisense; ATCTCTGCTCCGTGAGGTACTACAA
>probe:Drosophila_2:1639281_at:40:671; Interrogation_Position=649; Antisense; TACGATCCCCTAACCTATGTGGAGA
>probe:Drosophila_2:1639281_at:161:117; Interrogation_Position=732; Antisense; AGCTCGTCTGTCGTGGATCAACTGG
>probe:Drosophila_2:1639281_at:388:421; Interrogation_Position=757; Antisense; GAGAACCTCGGAGTACATCCTGGTA
>probe:Drosophila_2:1639281_at:50:309; Interrogation_Position=821; Antisense; CCATGTGCGGAGCTCATTGCGGAAT

Paste this into a BLAST search page for me
TTAATGTGCAACAGCCCCAGTGCCATGCAGGTGGTCCCAATCCTGGATATATGGATCCGTGGGAGCTGCAACTGCTGCAACTGCGTCCAGCTACAAAATGAAGGAAACGCATCCAGAGGTCCGCCGCCCCAACTGGTAGCATCAATTCGGGGCTTTCGATGAGCTAAGGGTCCATTGAGCAAGATCGACACTCTGCGGCTTTGCCATCGCCTATATATCTCTGCTATCTCTGCTCCGTGAGGTACTACAATACGATCCCCTAACCTATGTGGAGAAGCTCGTCTGTCGTGGATCAACTGGGAGAACCTCGGAGTACATCCTGGTACCATGTGCGGAGCTCATTGCGGAAT

Full Affymetrix probeset data:

Annotations for 1639281_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720