FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639282_at:

>probe:Drosophila_2:1639282_at:439:147; Interrogation_Position=104; Antisense; ACTACCTGGCGCTGGAGATCGTGAA
>probe:Drosophila_2:1639282_at:149:589; Interrogation_Position=116; Antisense; TGGAGATCGTGAAGCGATGCAGCCT
>probe:Drosophila_2:1639282_at:215:53; Interrogation_Position=13; Antisense; ATGCTGCAGCACACGATGACGAAGC
>probe:Drosophila_2:1639282_at:75:127; Interrogation_Position=136; Antisense; AGCCTGCGCCCGACGAATCTCAAGA
>probe:Drosophila_2:1639282_at:100:213; Interrogation_Position=157; Antisense; AAGACGCCGGCGGATATCATTGGAC
>probe:Drosophila_2:1639282_at:544:555; Interrogation_Position=178; Antisense; GGACTGCGGGATGAGGACACCATAC
>probe:Drosophila_2:1639282_at:114:559; Interrogation_Position=192; Antisense; GGACACCATACAGAATTCGCAGCGG
>probe:Drosophila_2:1639282_at:639:363; Interrogation_Position=204; Antisense; GAATTCGCAGCGGAATCTAGTCTTT
>probe:Drosophila_2:1639282_at:328:353; Interrogation_Position=210; Antisense; GCAGCGGAATCTAGTCTTTGTGGGC
>probe:Drosophila_2:1639282_at:554:121; Interrogation_Position=35; Antisense; AGCGGAAGACGCTGATCATCGGCTT
>probe:Drosophila_2:1639282_at:234:213; Interrogation_Position=40; Antisense; AAGACGCTGATCATCGGCTTCTTTG
>probe:Drosophila_2:1639282_at:202:605; Interrogation_Position=47; Antisense; TGATCATCGGCTTCTTTGGCATCGC
>probe:Drosophila_2:1639282_at:692:641; Interrogation_Position=80; Antisense; TCTGCATCGGCACCATGCTGAAGAA
>probe:Drosophila_2:1639282_at:266:53; Interrogation_Position=94; Antisense; ATGCTGAAGAACTACCTGGCGCTGG

Paste this into a BLAST search page for me
ACTACCTGGCGCTGGAGATCGTGAATGGAGATCGTGAAGCGATGCAGCCTATGCTGCAGCACACGATGACGAAGCAGCCTGCGCCCGACGAATCTCAAGAAAGACGCCGGCGGATATCATTGGACGGACTGCGGGATGAGGACACCATACGGACACCATACAGAATTCGCAGCGGGAATTCGCAGCGGAATCTAGTCTTTGCAGCGGAATCTAGTCTTTGTGGGCAGCGGAAGACGCTGATCATCGGCTTAAGACGCTGATCATCGGCTTCTTTGTGATCATCGGCTTCTTTGGCATCGCTCTGCATCGGCACCATGCTGAAGAAATGCTGAAGAACTACCTGGCGCTGG

Full Affymetrix probeset data:

Annotations for 1639282_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720