Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639287_at:

>probe:Drosophila_2:1639287_at:142:629; Interrogation_Position=125; Antisense; TCCCCAGTTCGGATATGGTGGCTTC
>probe:Drosophila_2:1639287_at:605:335; Interrogation_Position=145; Antisense; GCTTCGGAGGCGGATACCCCGGATA
>probe:Drosophila_2:1639287_at:608:541; Interrogation_Position=156; Antisense; GGATACCCCGGATACGGCGGATTCG
>probe:Drosophila_2:1639287_at:595:21; Interrogation_Position=188; Antisense; ATATCCTGGCTACGGCGGCTTCGGT
>probe:Drosophila_2:1639287_at:340:715; Interrogation_Position=207; Antisense; TTCGGTGGCGGATATCCTGGCTACG
>probe:Drosophila_2:1639287_at:596:21; Interrogation_Position=218; Antisense; ATATCCTGGCTACGGTGGCTTTAGG
>probe:Drosophila_2:1639287_at:148:641; Interrogation_Position=301; Antisense; TCGGCGGTGGCTTCTACGGATAGAA
>probe:Drosophila_2:1639287_at:721:419; Interrogation_Position=330; Antisense; GAGAAGATGATTAACCCTAAGCCTG
>probe:Drosophila_2:1639287_at:700:131; Interrogation_Position=343; Antisense; ACCCTAAGCCTGTTCAATTCAAATA
>probe:Drosophila_2:1639287_at:522:663; Interrogation_Position=35; Antisense; TAAAGTGAACAAGCCATCCAAGATG
>probe:Drosophila_2:1639287_at:243:313; Interrogation_Position=47; Antisense; GCCATCCAAGATGCGAGCTGCTATC
>probe:Drosophila_2:1639287_at:496:417; Interrogation_Position=61; Antisense; GAGCTGCTATCGTGTTTGTCGTTGT
>probe:Drosophila_2:1639287_at:580:691; Interrogation_Position=75; Antisense; TTTGTCGTTGTGATTTTCGCACTCC
>probe:Drosophila_2:1639287_at:94:703; Interrogation_Position=88; Antisense; TTTTCGCACTCCTCAGTGTCCTGGA

Paste this into a BLAST search page for me
TCCCCAGTTCGGATATGGTGGCTTCGCTTCGGAGGCGGATACCCCGGATAGGATACCCCGGATACGGCGGATTCGATATCCTGGCTACGGCGGCTTCGGTTTCGGTGGCGGATATCCTGGCTACGATATCCTGGCTACGGTGGCTTTAGGTCGGCGGTGGCTTCTACGGATAGAAGAGAAGATGATTAACCCTAAGCCTGACCCTAAGCCTGTTCAATTCAAATATAAAGTGAACAAGCCATCCAAGATGGCCATCCAAGATGCGAGCTGCTATCGAGCTGCTATCGTGTTTGTCGTTGTTTTGTCGTTGTGATTTTCGCACTCCTTTTCGCACTCCTCAGTGTCCTGGA

Full Affymetrix probeset data:

Annotations for 1639287_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime