FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639288_at:

>probe:Drosophila_2:1639288_at:518:439; Interrogation_Position=1826; Antisense; GAGGCTGCACAGGAACTGGCTCTTA
>probe:Drosophila_2:1639288_at:598:571; Interrogation_Position=1843; Antisense; GGCTCTTACTCGCATATTCACGGAC
>probe:Drosophila_2:1639288_at:108:461; Interrogation_Position=1871; Antisense; GATTTCAAGCGCATCAACGCGGCTA
>probe:Drosophila_2:1639288_at:698:707; Interrogation_Position=1899; Antisense; TTAAGAAGACCGTAACCAGTGCCCG
>probe:Drosophila_2:1639288_at:600:85; Interrogation_Position=1916; Antisense; AGTGCCCGCAAGAGACCACTTGAAC
>probe:Drosophila_2:1639288_at:579:257; Interrogation_Position=1932; Antisense; CACTTGAACAGGATCGCGCCGAGTT
>probe:Drosophila_2:1639288_at:476:63; Interrogation_Position=2070; Antisense; ATGGGCGCGTGAACGAGCACTGTTC
>probe:Drosophila_2:1639288_at:288:113; Interrogation_Position=2085; Antisense; AGCACTGTTCCAAGACGAACCGCGA
>probe:Drosophila_2:1639288_at:555:211; Interrogation_Position=2123; Antisense; AAGAACTTTGGCATGCTGCGACACA
>probe:Drosophila_2:1639288_at:678:255; Interrogation_Position=2144; Antisense; CACAAGGCTCGCTCCAAGGTTAAGA
>probe:Drosophila_2:1639288_at:401:577; Interrogation_Position=2191; Antisense; GGCGCTGAGAAAACATCTGCTGCAT
>probe:Drosophila_2:1639288_at:68:373; Interrogation_Position=2227; Antisense; GAAGTAGTACCTTCTTGCGTTTCAA
>probe:Drosophila_2:1639288_at:54:1; Interrogation_Position=2243; Antisense; GCGTTTCAAACCTCGTAGTGCTTTA
>probe:Drosophila_2:1639288_at:359:401; Interrogation_Position=2358; Antisense; GACTTTGTACGGTTGCCTATTCATT

Paste this into a BLAST search page for me
GAGGCTGCACAGGAACTGGCTCTTAGGCTCTTACTCGCATATTCACGGACGATTTCAAGCGCATCAACGCGGCTATTAAGAAGACCGTAACCAGTGCCCGAGTGCCCGCAAGAGACCACTTGAACCACTTGAACAGGATCGCGCCGAGTTATGGGCGCGTGAACGAGCACTGTTCAGCACTGTTCCAAGACGAACCGCGAAAGAACTTTGGCATGCTGCGACACACACAAGGCTCGCTCCAAGGTTAAGAGGCGCTGAGAAAACATCTGCTGCATGAAGTAGTACCTTCTTGCGTTTCAAGCGTTTCAAACCTCGTAGTGCTTTAGACTTTGTACGGTTGCCTATTCATT

Full Affymetrix probeset data:

Annotations for 1639288_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720