FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639289_at:

>probe:Drosophila_2:1639289_at:623:547; Interrogation_Position=113; Antisense; GGATGTTCGTGCTAATCTAGACAAC
>probe:Drosophila_2:1639289_at:618:231; Interrogation_Position=170; Antisense; AATGACGTACATATTGGGCACGGAA
>probe:Drosophila_2:1639289_at:443:91; Interrogation_Position=196; Antisense; AGTTTCAGACAATCCTAAGGCTCTT
>probe:Drosophila_2:1639289_at:681:71; Interrogation_Position=213; Antisense; AGGCTCTTGGAGGAGTCTTTACCAT
>probe:Drosophila_2:1639289_at:221:363; Interrogation_Position=251; Antisense; GCAATACCTGGAGATTCATGTGTCA
>probe:Drosophila_2:1639289_at:237:677; Interrogation_Position=26; Antisense; TAGACTTCTGCAAACTGCATCCACG
>probe:Drosophila_2:1639289_at:672:515; Interrogation_Position=270; Antisense; GTGTCAATTGCCATTTCACCTGGTG
>probe:Drosophila_2:1639289_at:613:573; Interrogation_Position=295; Antisense; GGCGGCTGGTTCAGGCCTACAAAAC
>probe:Drosophila_2:1639289_at:720:657; Interrogation_Position=320; Antisense; TAAGTGCAGGGCTCATGCAGCTCAA
>probe:Drosophila_2:1639289_at:656:351; Interrogation_Position=336; Antisense; GCAGCTCAACTTAAATCGGTGGCAA
>probe:Drosophila_2:1639289_at:392:173; Interrogation_Position=359; Antisense; AAAGCGAAAGGCTTCCACAGACTAG
>probe:Drosophila_2:1639289_at:676:545; Interrogation_Position=60; Antisense; GGATCCTTGCTTCATTTGCTGCTGA
>probe:Drosophila_2:1639289_at:91:407; Interrogation_Position=83; Antisense; GACTGCAAGGGCTGCTTGTGCCTCA
>probe:Drosophila_2:1639289_at:93:729; Interrogation_Position=98; Antisense; TTGTGCCTCAACCATGGATGTTCGT

Paste this into a BLAST search page for me
GGATGTTCGTGCTAATCTAGACAACAATGACGTACATATTGGGCACGGAAAGTTTCAGACAATCCTAAGGCTCTTAGGCTCTTGGAGGAGTCTTTACCATGCAATACCTGGAGATTCATGTGTCATAGACTTCTGCAAACTGCATCCACGGTGTCAATTGCCATTTCACCTGGTGGGCGGCTGGTTCAGGCCTACAAAACTAAGTGCAGGGCTCATGCAGCTCAAGCAGCTCAACTTAAATCGGTGGCAAAAAGCGAAAGGCTTCCACAGACTAGGGATCCTTGCTTCATTTGCTGCTGAGACTGCAAGGGCTGCTTGTGCCTCATTGTGCCTCAACCATGGATGTTCGT

Full Affymetrix probeset data:

Annotations for 1639289_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720