Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639290_at:

>probe:Drosophila_2:1639290_at:422:729; Interrogation_Position=106; Antisense; TTGTGCGGGCCAAGTGCGTGACAAA
>probe:Drosophila_2:1639290_at:236:455; Interrogation_Position=148; Antisense; GATAAGGCCATATGCATACGAAAGA
>probe:Drosophila_2:1639290_at:150:27; Interrogation_Position=163; Antisense; ATACGAAAGATTGTCGCCGCACCTC
>probe:Drosophila_2:1639290_at:162:503; Interrogation_Position=188; Antisense; GTCGCGCCACGCAGACAAAGATCGA
>probe:Drosophila_2:1639290_at:685:117; Interrogation_Position=222; Antisense; AGCTCGAAAATGGTCGTGTCCACTT
>probe:Drosophila_2:1639290_at:150:517; Interrogation_Position=237; Antisense; GTGTCCACTTTGCACATAACGCTGG
>probe:Drosophila_2:1639290_at:563:31; Interrogation_Position=252; Antisense; ATAACGCTGGAGAACAACGGCAATG
>probe:Drosophila_2:1639290_at:515:177; Interrogation_Position=329; Antisense; AACATCGCCGACCAAGTTTGCCGTG
>probe:Drosophila_2:1639290_at:25:517; Interrogation_Position=496; Antisense; GTGGTGGACCGGGATCTCTGACCCC
>probe:Drosophila_2:1639290_at:265:243; Interrogation_Position=535; Antisense; AATATGTCGGCTCACCTGTATCATC
>probe:Drosophila_2:1639290_at:426:283; Interrogation_Position=591; Antisense; CTGCGTCGCGGCATTCAAATTCAAC
>probe:Drosophila_2:1639290_at:468:163; Interrogation_Position=607; Antisense; AAATTCAACGATCCTCGACGCGTTT
>probe:Drosophila_2:1639290_at:176:411; Interrogation_Position=623; Antisense; GACGCGTTTGCGACAACAACAGGCA
>probe:Drosophila_2:1639290_at:84:693; Interrogation_Position=85; Antisense; TTTGTTTTATTCTCTTCGCTGTTGT

Paste this into a BLAST search page for me
TTGTGCGGGCCAAGTGCGTGACAAAGATAAGGCCATATGCATACGAAAGAATACGAAAGATTGTCGCCGCACCTCGTCGCGCCACGCAGACAAAGATCGAAGCTCGAAAATGGTCGTGTCCACTTGTGTCCACTTTGCACATAACGCTGGATAACGCTGGAGAACAACGGCAATGAACATCGCCGACCAAGTTTGCCGTGGTGGTGGACCGGGATCTCTGACCCCAATATGTCGGCTCACCTGTATCATCCTGCGTCGCGGCATTCAAATTCAACAAATTCAACGATCCTCGACGCGTTTGACGCGTTTGCGACAACAACAGGCATTTGTTTTATTCTCTTCGCTGTTGT

Full Affymetrix probeset data:

Annotations for 1639290_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime