FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639292_at:

>probe:Drosophila_2:1639292_at:412:439; Interrogation_Position=1009; Antisense; GATGGACAAAAACCACGATGGCAAA
>probe:Drosophila_2:1639292_at:400:693; Interrogation_Position=1049; Antisense; TTTCGTGAGGGTAGTAAAGCTGATC
>probe:Drosophila_2:1639292_at:661:633; Interrogation_Position=1113; Antisense; TCGATTAACAATGGCCGATTACCGA
>probe:Drosophila_2:1639292_at:611:461; Interrogation_Position=1129; Antisense; GATTACCGATAACAGACCCGATTCC
>probe:Drosophila_2:1639292_at:327:265; Interrogation_Position=1141; Antisense; CAGACCCGATTCCAATTCCACAAAA
>probe:Drosophila_2:1639292_at:479:719; Interrogation_Position=1156; Antisense; TTCCACAAAAACCAAGCGCGCAATA
>probe:Drosophila_2:1639292_at:505:361; Interrogation_Position=1207; Antisense; GCAAGTTGATCGAAACCCGCTTAAA
>probe:Drosophila_2:1639292_at:175:627; Interrogation_Position=1316; Antisense; TGCCGCTTCGTTTGCATTCGCTTCT
>probe:Drosophila_2:1639292_at:176:629; Interrogation_Position=1363; Antisense; TCCACGCTTTTCTCAATTCTCAATT
>probe:Drosophila_2:1639292_at:550:653; Interrogation_Position=1382; Antisense; TCAATTCTTGATTCTCGATTCTCCG
>probe:Drosophila_2:1639292_at:621:291; Interrogation_Position=1409; Antisense; CGTCGCTTGCGACACTGAAGATGAT
>probe:Drosophila_2:1639292_at:406:253; Interrogation_Position=880; Antisense; CAACGATGGTTACATAACGCGGGAG
>probe:Drosophila_2:1639292_at:545:51; Interrogation_Position=924; Antisense; ATGCGATCTACCAGATGGTGGGACA
>probe:Drosophila_2:1639292_at:365:399; Interrogation_Position=945; Antisense; GACAGCAGCCGCAATCGGAGGACGA

Paste this into a BLAST search page for me
GATGGACAAAAACCACGATGGCAAATTTCGTGAGGGTAGTAAAGCTGATCTCGATTAACAATGGCCGATTACCGAGATTACCGATAACAGACCCGATTCCCAGACCCGATTCCAATTCCACAAAATTCCACAAAAACCAAGCGCGCAATAGCAAGTTGATCGAAACCCGCTTAAATGCCGCTTCGTTTGCATTCGCTTCTTCCACGCTTTTCTCAATTCTCAATTTCAATTCTTGATTCTCGATTCTCCGCGTCGCTTGCGACACTGAAGATGATCAACGATGGTTACATAACGCGGGAGATGCGATCTACCAGATGGTGGGACAGACAGCAGCCGCAATCGGAGGACGA

Full Affymetrix probeset data:

Annotations for 1639292_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720