FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639295_at:

>probe:Drosophila_2:1639295_at:578:401; Interrogation_Position=439; Antisense; GACATGACCGTCACGCAGCTGGAGT
>probe:Drosophila_2:1639295_at:246:129; Interrogation_Position=511; Antisense; ACCATTGAGAGTCGTGCCAGCACCA
>probe:Drosophila_2:1639295_at:123:503; Interrogation_Position=606; Antisense; GTCCTTCAACTACAACGATGGCGAT
>probe:Drosophila_2:1639295_at:318:67; Interrogation_Position=629; Antisense; ATGGCATCTATCCATCTCGCATGAA
>probe:Drosophila_2:1639295_at:429:657; Interrogation_Position=687; Antisense; TAAGACTCTAACCATTCGCGCCTAT
>probe:Drosophila_2:1639295_at:357:635; Interrogation_Position=702; Antisense; TCGCGCCTATGACTTCAACGTGGGA
>probe:Drosophila_2:1639295_at:496:517; Interrogation_Position=721; Antisense; GTGGGAGATGTGGTTTCCGCTTCCA
>probe:Drosophila_2:1639295_at:476:343; Interrogation_Position=739; Antisense; GCTTCCACCTTGATGACCGATGAGA
>probe:Drosophila_2:1639295_at:165:51; Interrogation_Position=797; Antisense; ATGCCGATTTTCTGATGGTGCCACA
>probe:Drosophila_2:1639295_at:1:537; Interrogation_Position=813; Antisense; GGTGCCACAGGCAACCTTTGAGGAT
>probe:Drosophila_2:1639295_at:16:131; Interrogation_Position=853; Antisense; ACCTACTTCTGTGGCTCCATTAAGA
>probe:Drosophila_2:1639295_at:616:535; Interrogation_Position=885; Antisense; GGTCATATCGAGCAACAATCCCGGT
>probe:Drosophila_2:1639295_at:695:233; Interrogation_Position=900; Antisense; CAATCCCGGTCCTTTAATGGTTCTG
>probe:Drosophila_2:1639295_at:524:57; Interrogation_Position=953; Antisense; ATGAGGCTGGCTTTGCATTCACCTA

Paste this into a BLAST search page for me
GACATGACCGTCACGCAGCTGGAGTACCATTGAGAGTCGTGCCAGCACCAGTCCTTCAACTACAACGATGGCGATATGGCATCTATCCATCTCGCATGAATAAGACTCTAACCATTCGCGCCTATTCGCGCCTATGACTTCAACGTGGGAGTGGGAGATGTGGTTTCCGCTTCCAGCTTCCACCTTGATGACCGATGAGAATGCCGATTTTCTGATGGTGCCACAGGTGCCACAGGCAACCTTTGAGGATACCTACTTCTGTGGCTCCATTAAGAGGTCATATCGAGCAACAATCCCGGTCAATCCCGGTCCTTTAATGGTTCTGATGAGGCTGGCTTTGCATTCACCTA

Full Affymetrix probeset data:

Annotations for 1639295_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720