FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639296_at:

>probe:Drosophila_2:1639296_at:422:439; Interrogation_Position=1026; Antisense; GAGGCTCATTTTGCATGGCCCTCAA
>probe:Drosophila_2:1639296_at:14:707; Interrogation_Position=1094; Antisense; TTCGGACCCTTCGTGGAGCAAACAT
>probe:Drosophila_2:1639296_at:415:601; Interrogation_Position=1134; Antisense; TGTTGCCGCCTTTATTCGGACGAAA
>probe:Drosophila_2:1639296_at:311:203; Interrogation_Position=1174; Antisense; AACCACAGTGGTTTCCATCGGATGC
>probe:Drosophila_2:1639296_at:545:433; Interrogation_Position=1200; Antisense; GAGTGTTTCACATGGGCGCCGTCAA
>probe:Drosophila_2:1639296_at:208:193; Interrogation_Position=1223; Antisense; AACTCGGACGGAGATCTCTTCATGT
>probe:Drosophila_2:1639296_at:134:211; Interrogation_Position=1310; Antisense; AAGGCGGCCATCAACGGAAAGGTCA
>probe:Drosophila_2:1639296_at:30:393; Interrogation_Position=1326; Antisense; GAAAGGTCACCAAAGTGGCCTACGG
>probe:Drosophila_2:1639296_at:170:581; Interrogation_Position=1341; Antisense; TGGCCTACGGAGTGGATCACACCAT
>probe:Drosophila_2:1639296_at:232:545; Interrogation_Position=1354; Antisense; GGATCACACCATTGCCTTGTGCAAG
>probe:Drosophila_2:1639296_at:539:509; Interrogation_Position=1372; Antisense; GTGCAAGCCGTTCTTCTAGATTAAG
>probe:Drosophila_2:1639296_at:548:241; Interrogation_Position=1441; Antisense; AATACTATTGCCAGTGGCAGCCCAA
>probe:Drosophila_2:1639296_at:288:341; Interrogation_Position=931; Antisense; GCTAGATGACTCAGAGCTGGCCGAA
>probe:Drosophila_2:1639296_at:719:239; Interrogation_Position=961; Antisense; AATAAATATCCCTAGAGCTCTCAAA

Paste this into a BLAST search page for me
GAGGCTCATTTTGCATGGCCCTCAATTCGGACCCTTCGTGGAGCAAACATTGTTGCCGCCTTTATTCGGACGAAAAACCACAGTGGTTTCCATCGGATGCGAGTGTTTCACATGGGCGCCGTCAAAACTCGGACGGAGATCTCTTCATGTAAGGCGGCCATCAACGGAAAGGTCAGAAAGGTCACCAAAGTGGCCTACGGTGGCCTACGGAGTGGATCACACCATGGATCACACCATTGCCTTGTGCAAGGTGCAAGCCGTTCTTCTAGATTAAGAATACTATTGCCAGTGGCAGCCCAAGCTAGATGACTCAGAGCTGGCCGAAAATAAATATCCCTAGAGCTCTCAAA

Full Affymetrix probeset data:

Annotations for 1639296_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720