FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639297_at:

>probe:Drosophila_2:1639297_at:515:595; Interrogation_Position=115; Antisense; TGTGGTTGTGCCGTTTGCCAACTCA
>probe:Drosophila_2:1639297_at:161:617; Interrogation_Position=155; Antisense; TGCACATCGCCGTCTGGATGCAAAA
>probe:Drosophila_2:1639297_at:639:545; Interrogation_Position=170; Antisense; GGATGCAAAAGTCCTTCCTCCGAAA
>probe:Drosophila_2:1639297_at:252:457; Interrogation_Position=240; Antisense; GATACCATAGTAATGTGCCCACCGT
>probe:Drosophila_2:1639297_at:313:507; Interrogation_Position=254; Antisense; GTGCCCACCGTTAATGGCAGTCTGA
>probe:Drosophila_2:1639297_at:47:267; Interrogation_Position=271; Antisense; CAGTCTGAGTTTTTCGTGTGCCAAT
>probe:Drosophila_2:1639297_at:488:311; Interrogation_Position=290; Antisense; GCCAATCTCACTTACTATCATGCAG
>probe:Drosophila_2:1639297_at:23:109; Interrogation_Position=313; Antisense; AGCAAACTACACTCACACCTTTGAG
>probe:Drosophila_2:1639297_at:466:199; Interrogation_Position=361; Antisense; AACGAATGTCTGCAATCTTTCCCTG
>probe:Drosophila_2:1639297_at:664:695; Interrogation_Position=378; Antisense; TTTCCCTGAACAACACCGCGAGTGG
>probe:Drosophila_2:1639297_at:116:133; Interrogation_Position=431; Antisense; ACCGACTACTGCAATCCAGCTGGAA
>probe:Drosophila_2:1639297_at:14:499; Interrogation_Position=470; Antisense; GTCTATACAATCGTGGGATCCGCCA
>probe:Drosophila_2:1639297_at:133:547; Interrogation_Position=485; Antisense; GGATCCGCCATTGCCGTGATTTTGG
>probe:Drosophila_2:1639297_at:221:655; Interrogation_Position=87; Antisense; TAATTTTCTGTGTGGTGCTTGTGGC

Paste this into a BLAST search page for me
TGTGGTTGTGCCGTTTGCCAACTCATGCACATCGCCGTCTGGATGCAAAAGGATGCAAAAGTCCTTCCTCCGAAAGATACCATAGTAATGTGCCCACCGTGTGCCCACCGTTAATGGCAGTCTGACAGTCTGAGTTTTTCGTGTGCCAATGCCAATCTCACTTACTATCATGCAGAGCAAACTACACTCACACCTTTGAGAACGAATGTCTGCAATCTTTCCCTGTTTCCCTGAACAACACCGCGAGTGGACCGACTACTGCAATCCAGCTGGAAGTCTATACAATCGTGGGATCCGCCAGGATCCGCCATTGCCGTGATTTTGGTAATTTTCTGTGTGGTGCTTGTGGC

Full Affymetrix probeset data:

Annotations for 1639297_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720