FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639298_at:

>probe:Drosophila_2:1639298_at:363:553; Interrogation_Position=1848; Antisense; GGAGCAGCAACCCAACGTCGATGTG
>probe:Drosophila_2:1639298_at:361:649; Interrogation_Position=1878; Antisense; TCAGCTGGCCCAGTGCCAAATGGAA
>probe:Drosophila_2:1639298_at:706:75; Interrogation_Position=1928; Antisense; AGGAGCTTCTCCGACAGAGGGATCT
>probe:Drosophila_2:1639298_at:166:101; Interrogation_Position=1943; Antisense; AGAGGGATCTCTTCTGCGAACAGCT
>probe:Drosophila_2:1639298_at:536:653; Interrogation_Position=1967; Antisense; TCAAGTCCACCCAAGACGATCTGGA
>probe:Drosophila_2:1639298_at:553:449; Interrogation_Position=1984; Antisense; GATCTGGACACTCTGCGAACTGAAT
>probe:Drosophila_2:1639298_at:43:429; Interrogation_Position=2092; Antisense; GAGTTGGCTCAGTGCCGAGCAACTG
>probe:Drosophila_2:1639298_at:146:195; Interrogation_Position=2112; Antisense; AACTGCCTCGCTGTCGGTCAACGAT
>probe:Drosophila_2:1639298_at:681:599; Interrogation_Position=2145; Antisense; TGTCATCCGCGAGATGCAGGGTCAA
>probe:Drosophila_2:1639298_at:682:81; Interrogation_Position=2162; Antisense; AGGGTCAACTGAACACACTCTCCTA
>probe:Drosophila_2:1639298_at:173:63; Interrogation_Position=2240; Antisense; ATGTGTCCAACGAAAACTGCTTCCC
>probe:Drosophila_2:1639298_at:574:617; Interrogation_Position=2257; Antisense; TGCTTCCCCGTCAAGTGCTAAATGG
>probe:Drosophila_2:1639298_at:130:563; Interrogation_Position=2292; Antisense; GGAACCATTTCGAATTCACATGCAT
>probe:Drosophila_2:1639298_at:334:467; Interrogation_Position=2347; Antisense; GTAGCTTGCGTTCGAAAACCATTCA

Paste this into a BLAST search page for me
GGAGCAGCAACCCAACGTCGATGTGTCAGCTGGCCCAGTGCCAAATGGAAAGGAGCTTCTCCGACAGAGGGATCTAGAGGGATCTCTTCTGCGAACAGCTTCAAGTCCACCCAAGACGATCTGGAGATCTGGACACTCTGCGAACTGAATGAGTTGGCTCAGTGCCGAGCAACTGAACTGCCTCGCTGTCGGTCAACGATTGTCATCCGCGAGATGCAGGGTCAAAGGGTCAACTGAACACACTCTCCTAATGTGTCCAACGAAAACTGCTTCCCTGCTTCCCCGTCAAGTGCTAAATGGGGAACCATTTCGAATTCACATGCATGTAGCTTGCGTTCGAAAACCATTCA

Full Affymetrix probeset data:

Annotations for 1639298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720