FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639299_at:

>probe:Drosophila_2:1639299_at:585:367; Interrogation_Position=1015; Antisense; GAATCCCAGTATCATGGTGTCCCAA
>probe:Drosophila_2:1639299_at:97:513; Interrogation_Position=1061; Antisense; GTGACCATCCATTGAATGCGGCTCT
>probe:Drosophila_2:1639299_at:575:573; Interrogation_Position=1105; Antisense; GGCGTTTCACTTGATTTGCAGACCA
>probe:Drosophila_2:1639299_at:289:35; Interrogation_Position=1129; Antisense; ATCACCGAAGATACTTTCCGCGAGG
>probe:Drosophila_2:1639299_at:502:325; Interrogation_Position=1148; Antisense; GCGAGGCCATCAACGAAGTCCTGGA
>probe:Drosophila_2:1639299_at:264:161; Interrogation_Position=1178; Antisense; ACAAGTACACTCAAGCGGTTCGCAA
>probe:Drosophila_2:1639299_at:95:363; Interrogation_Position=1242; Antisense; GCAATCTGTTCTTTTCTGGGTGGAT
>probe:Drosophila_2:1639299_at:49:715; Interrogation_Position=1271; Antisense; TTCTGAGGCATCATGGTGCTCCCAA
>probe:Drosophila_2:1639299_at:475:535; Interrogation_Position=1285; Antisense; GGTGCTCCCAATTTGCAGAGTCCAG
>probe:Drosophila_2:1639299_at:8:431; Interrogation_Position=1302; Antisense; GAGTCCAGCGGTGCACATGGGATTT
>probe:Drosophila_2:1639299_at:451:191; Interrogation_Position=1339; Antisense; AACTTGGATATCTACGCCTTGGTGC
>probe:Drosophila_2:1639299_at:443:535; Interrogation_Position=1359; Antisense; GGTGCTTGCGATCCTGATATTCTTA
>probe:Drosophila_2:1639299_at:703:629; Interrogation_Position=1388; Antisense; TCCTAACCCGGCTAACTGTGAAATT
>probe:Drosophila_2:1639299_at:505:177; Interrogation_Position=976; Antisense; AAACTCTTTGTCACACATGCCGGCA

Paste this into a BLAST search page for me
GAATCCCAGTATCATGGTGTCCCAAGTGACCATCCATTGAATGCGGCTCTGGCGTTTCACTTGATTTGCAGACCAATCACCGAAGATACTTTCCGCGAGGGCGAGGCCATCAACGAAGTCCTGGAACAAGTACACTCAAGCGGTTCGCAAGCAATCTGTTCTTTTCTGGGTGGATTTCTGAGGCATCATGGTGCTCCCAAGGTGCTCCCAATTTGCAGAGTCCAGGAGTCCAGCGGTGCACATGGGATTTAACTTGGATATCTACGCCTTGGTGCGGTGCTTGCGATCCTGATATTCTTATCCTAACCCGGCTAACTGTGAAATTAAACTCTTTGTCACACATGCCGGCA

Full Affymetrix probeset data:

Annotations for 1639299_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720