FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639301_at:

>probe:Drosophila_2:1639301_at:549:421; Interrogation_Position=1134; Antisense; GAGCAAATCGCAACGTTGGCCAACT
>probe:Drosophila_2:1639301_at:211:193; Interrogation_Position=1155; Antisense; AACTGCTTTACGTCTGCGTCAAGTT
>probe:Drosophila_2:1639301_at:530:561; Interrogation_Position=1189; Antisense; GGAATGTCCGTTCAGATCCTGACGC
>probe:Drosophila_2:1639301_at:47:309; Interrogation_Position=1226; Antisense; CCATTCGCCAGGTCTTTGTCAAGGA
>probe:Drosophila_2:1639301_at:15:157; Interrogation_Position=1250; Antisense; ACACGATTGTGATGCGCTGGTTTAT
>probe:Drosophila_2:1639301_at:293:691; Interrogation_Position=1272; Antisense; TATTGTCATCAGCTGGTTTTCACCC
>probe:Drosophila_2:1639301_at:577:27; Interrogation_Position=1303; Antisense; ATAGCCATCGTCTACGTTTTTCTGA
>probe:Drosophila_2:1639301_at:259:477; Interrogation_Position=1318; Antisense; GTTTTTCTGATCAACGTACTGCGAG
>probe:Drosophila_2:1639301_at:96:43; Interrogation_Position=1345; Antisense; ATCGTGCGAAAGTTACATCCCCAGT
>probe:Drosophila_2:1639301_at:437:273; Interrogation_Position=1416; Antisense; CATTATTCTGGTACCGCTGTTCGGA
>probe:Drosophila_2:1639301_at:375:555; Interrogation_Position=1488; Antisense; GGACCACTTCTATCAGATGCTATCG
>probe:Drosophila_2:1639301_at:93:685; Interrogation_Position=1508; Antisense; TATCGGTGGTGTTGGTCAGCCTGCA
>probe:Drosophila_2:1639301_at:360:239; Interrogation_Position=1567; Antisense; AATCACGATGTCACCTTTGCCATTC
>probe:Drosophila_2:1639301_at:251:333; Interrogation_Position=1599; Antisense; GCTGAACAAGTTGCTGCCCAGTTTA

Paste this into a BLAST search page for me
GAGCAAATCGCAACGTTGGCCAACTAACTGCTTTACGTCTGCGTCAAGTTGGAATGTCCGTTCAGATCCTGACGCCCATTCGCCAGGTCTTTGTCAAGGAACACGATTGTGATGCGCTGGTTTATTATTGTCATCAGCTGGTTTTCACCCATAGCCATCGTCTACGTTTTTCTGAGTTTTTCTGATCAACGTACTGCGAGATCGTGCGAAAGTTACATCCCCAGTCATTATTCTGGTACCGCTGTTCGGAGGACCACTTCTATCAGATGCTATCGTATCGGTGGTGTTGGTCAGCCTGCAAATCACGATGTCACCTTTGCCATTCGCTGAACAAGTTGCTGCCCAGTTTA

Full Affymetrix probeset data:

Annotations for 1639301_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720