FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639302_at:

>probe:Drosophila_2:1639302_at:537:181; Interrogation_Position=2165; Antisense; AAAACAGTCCACAAAGCACGGAGAA
>probe:Drosophila_2:1639302_at:220:1; Interrogation_Position=2228; Antisense; AGCCTAAAAACGTGCAAAATGGATT
>probe:Drosophila_2:1639302_at:323:357; Interrogation_Position=2284; Antisense; GCAAAGACAAAGTCGAACCAACCAT
>probe:Drosophila_2:1639302_at:278:179; Interrogation_Position=2312; Antisense; AAACTACGGAAAGTGCGCCTGCAAA
>probe:Drosophila_2:1639302_at:722:537; Interrogation_Position=2353; Antisense; GGTAATAATCCTTTCAATAAGCCAC
>probe:Drosophila_2:1639302_at:705:239; Interrogation_Position=2368; Antisense; AATAAGCCACAATCGAAATCCCAAC
>probe:Drosophila_2:1639302_at:170:567; Interrogation_Position=2396; Antisense; GGCAGGAACTGCCACCAATTCATAA
>probe:Drosophila_2:1639302_at:682:409; Interrogation_Position=2444; Antisense; GACCGAGAAACGCTAACGGCACCAA
>probe:Drosophila_2:1639302_at:660:567; Interrogation_Position=2461; Antisense; GGCACCAATCCCTTTAAGAAATCAA
>probe:Drosophila_2:1639302_at:593:253; Interrogation_Position=2483; Antisense; CAAACCAAAAGCCAAGTGCACCCTT
>probe:Drosophila_2:1639302_at:565:615; Interrogation_Position=2499; Antisense; TGCACCCTTCCCAGCTAAGAAAACG
>probe:Drosophila_2:1639302_at:89:3; Interrogation_Position=2558; Antisense; ATAGTGGAATAACCGACGATCGATT
>probe:Drosophila_2:1639302_at:193:139; Interrogation_Position=2573; Antisense; ACGATCGATTAAAGGCATATGGCAT
>probe:Drosophila_2:1639302_at:636:569; Interrogation_Position=2593; Antisense; GGCATAAATCCCAGAAAATTCCACA

Paste this into a BLAST search page for me
AAAACAGTCCACAAAGCACGGAGAAAGCCTAAAAACGTGCAAAATGGATTGCAAAGACAAAGTCGAACCAACCATAAACTACGGAAAGTGCGCCTGCAAAGGTAATAATCCTTTCAATAAGCCACAATAAGCCACAATCGAAATCCCAACGGCAGGAACTGCCACCAATTCATAAGACCGAGAAACGCTAACGGCACCAAGGCACCAATCCCTTTAAGAAATCAACAAACCAAAAGCCAAGTGCACCCTTTGCACCCTTCCCAGCTAAGAAAACGATAGTGGAATAACCGACGATCGATTACGATCGATTAAAGGCATATGGCATGGCATAAATCCCAGAAAATTCCACA

Full Affymetrix probeset data:

Annotations for 1639302_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720