FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639303_at:

>probe:Drosophila_2:1639303_at:12:39; Interrogation_Position=1019; Antisense; ATCTCATACTGACGATCCTGCTGTT
>probe:Drosophila_2:1639303_at:695:715; Interrogation_Position=1049; Antisense; TTCTGTTTTCTCATGGGCCCATTTA
>probe:Drosophila_2:1639303_at:686:535; Interrogation_Position=1096; Antisense; GGTCTCCAGCCGACAGTCATTGGAT
>probe:Drosophila_2:1639303_at:534:31; Interrogation_Position=1126; Antisense; ATAATCTTCGGCTTTGTACTGACTC
>probe:Drosophila_2:1639303_at:201:489; Interrogation_Position=1141; Antisense; GTACTGACTCCATACATGACACTGG
>probe:Drosophila_2:1639303_at:500:575; Interrogation_Position=1164; Antisense; GGCGAACTTCAGTATGCTTAGCATG
>probe:Drosophila_2:1639303_at:496:675; Interrogation_Position=1182; Antisense; TAGCATGACGCGTTGCTTTGAGTAC
>probe:Drosophila_2:1639303_at:435:23; Interrogation_Position=1214; Antisense; ATAGGTTTGCCTACCAGCTCGGATA
>probe:Drosophila_2:1639303_at:251:423; Interrogation_Position=1244; Antisense; GAGAACTTCGACAAGCACTGCTCAA
>probe:Drosophila_2:1639303_at:585:51; Interrogation_Position=1274; Antisense; ATGCGGATAATCTGGCATTCCCCGT
>probe:Drosophila_2:1639303_at:540:545; Interrogation_Position=1302; Antisense; GGATCCTTGCTACTCCAGCTGGAAT
>probe:Drosophila_2:1639303_at:338:343; Interrogation_Position=1421; Antisense; GCTTCTGATTGAGTTATCCGTCTTG
>probe:Drosophila_2:1639303_at:558:149; Interrogation_Position=924; Antisense; ACTTGCGGATCCTCAGGTGGTTGCT
>probe:Drosophila_2:1639303_at:683:665; Interrogation_Position=991; Antisense; TACAAAGCTATCATGGCGTTCCAAG

Paste this into a BLAST search page for me
ATCTCATACTGACGATCCTGCTGTTTTCTGTTTTCTCATGGGCCCATTTAGGTCTCCAGCCGACAGTCATTGGATATAATCTTCGGCTTTGTACTGACTCGTACTGACTCCATACATGACACTGGGGCGAACTTCAGTATGCTTAGCATGTAGCATGACGCGTTGCTTTGAGTACATAGGTTTGCCTACCAGCTCGGATAGAGAACTTCGACAAGCACTGCTCAAATGCGGATAATCTGGCATTCCCCGTGGATCCTTGCTACTCCAGCTGGAATGCTTCTGATTGAGTTATCCGTCTTGACTTGCGGATCCTCAGGTGGTTGCTTACAAAGCTATCATGGCGTTCCAAG

Full Affymetrix probeset data:

Annotations for 1639303_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720