FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639307_at:

>probe:Drosophila_2:1639307_at:49:461; Interrogation_Position=1033; Antisense; GATTCAGGCGTGATTTTGACCCTTG
>probe:Drosophila_2:1639307_at:21:411; Interrogation_Position=1050; Antisense; GACCCTTGTTTTGTTGTGCTTCTTC
>probe:Drosophila_2:1639307_at:127:509; Interrogation_Position=1065; Antisense; GTGCTTCTTCTATAAGGCCTTTGTA
>probe:Drosophila_2:1639307_at:376:691; Interrogation_Position=597; Antisense; TTTGTCTGATTTGCCTGGCTCCCGA
>probe:Drosophila_2:1639307_at:36:677; Interrogation_Position=633; Antisense; TAGCTCAAGGCATCTCATCGGTCAA
>probe:Drosophila_2:1639307_at:688:569; Interrogation_Position=641; Antisense; GGCATCTCATCGGTCAACTTTGATA
>probe:Drosophila_2:1639307_at:33:81; Interrogation_Position=667; Antisense; AGGGAACGTAGATCGCAGCCAGAAT
>probe:Drosophila_2:1639307_at:334:369; Interrogation_Position=720; Antisense; GAATGATCCTACAGGCGGAGTCCAC
>probe:Drosophila_2:1639307_at:23:559; Interrogation_Position=774; Antisense; GGACTTACAAGGTGCCCAGCTGCAT
>probe:Drosophila_2:1639307_at:4:189; Interrogation_Position=821; Antisense; AACACCGCCATTGTGGAGGAGCCAA
>probe:Drosophila_2:1639307_at:116:171; Interrogation_Position=844; Antisense; AAAGCTTCTGGAGCAACTCCCCGAG
>probe:Drosophila_2:1639307_at:86:435; Interrogation_Position=866; Antisense; GAGGGAGCCGGCTACTTCGCCATTC
>probe:Drosophila_2:1639307_at:194:145; Interrogation_Position=909; Antisense; ACTGCGATGCAATCAAGGCGAGTCT
>probe:Drosophila_2:1639307_at:130:71; Interrogation_Position=924; Antisense; AGGCGAGTCTTTTAACCCAGGAGCA

Paste this into a BLAST search page for me
GATTCAGGCGTGATTTTGACCCTTGGACCCTTGTTTTGTTGTGCTTCTTCGTGCTTCTTCTATAAGGCCTTTGTATTTGTCTGATTTGCCTGGCTCCCGATAGCTCAAGGCATCTCATCGGTCAAGGCATCTCATCGGTCAACTTTGATAAGGGAACGTAGATCGCAGCCAGAATGAATGATCCTACAGGCGGAGTCCACGGACTTACAAGGTGCCCAGCTGCATAACACCGCCATTGTGGAGGAGCCAAAAAGCTTCTGGAGCAACTCCCCGAGGAGGGAGCCGGCTACTTCGCCATTCACTGCGATGCAATCAAGGCGAGTCTAGGCGAGTCTTTTAACCCAGGAGCA

Full Affymetrix probeset data:

Annotations for 1639307_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720