Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639308_at:

>probe:Drosophila_2:1639308_at:459:617; Interrogation_Position=1616; Antisense; TGCACGCCGAGCTCAAGCGGAACAA
>probe:Drosophila_2:1639308_at:5:219; Interrogation_Position=1639; Antisense; AAGTACAGCTCCAGCAAGGCGCAAA
>probe:Drosophila_2:1639308_at:115:173; Interrogation_Position=1661; Antisense; AAACGCTAAGGGATCCGCACCAAAT
>probe:Drosophila_2:1639308_at:726:43; Interrogation_Position=1673; Antisense; ATCCGCACCAAATGGCCACCAAATT
>probe:Drosophila_2:1639308_at:247:309; Interrogation_Position=1688; Antisense; CCACCAAATTGGACTGCGAGATGGA
>probe:Drosophila_2:1639308_at:276:329; Interrogation_Position=1724; Antisense; GCGTCAGCTTCGATCTGCACGAGGA
>probe:Drosophila_2:1639308_at:138:553; Interrogation_Position=1749; Antisense; GGAGCTCAATGAACTTACTCACGAC
>probe:Drosophila_2:1639308_at:370:667; Interrogation_Position=1764; Antisense; TACTCACGACGTTTAGGGATACTGT
>probe:Drosophila_2:1639308_at:290:223; Interrogation_Position=1798; Antisense; AAGGTGTACTTTAGAGACGAGCGAC
>probe:Drosophila_2:1639308_at:260:409; Interrogation_Position=1813; Antisense; GACGAGCGACAGTGGAGCATTCAAT
>probe:Drosophila_2:1639308_at:130:689; Interrogation_Position=1881; Antisense; TATTAGCTTCTTTGCCATTTGCCAT
>probe:Drosophila_2:1639308_at:323:273; Interrogation_Position=1910; Antisense; CATTTGCCATTGCTTGTGTCTACAT
>probe:Drosophila_2:1639308_at:287:535; Interrogation_Position=1924; Antisense; TGTGTCTACATTAGGTAACCCATAC
>probe:Drosophila_2:1639308_at:209:667; Interrogation_Position=1946; Antisense; TACTAACCTTTTACATTTCCACTCT

Paste this into a BLAST search page for me
TGCACGCCGAGCTCAAGCGGAACAAAAGTACAGCTCCAGCAAGGCGCAAAAAACGCTAAGGGATCCGCACCAAATATCCGCACCAAATGGCCACCAAATTCCACCAAATTGGACTGCGAGATGGAGCGTCAGCTTCGATCTGCACGAGGAGGAGCTCAATGAACTTACTCACGACTACTCACGACGTTTAGGGATACTGTAAGGTGTACTTTAGAGACGAGCGACGACGAGCGACAGTGGAGCATTCAATTATTAGCTTCTTTGCCATTTGCCATCATTTGCCATTGCTTGTGTCTACATTGTGTCTACATTAGGTAACCCATACTACTAACCTTTTACATTTCCACTCT

Full Affymetrix probeset data:

Annotations for 1639308_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime