FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639309_at:

>probe:Drosophila_2:1639309_at:541:535; Interrogation_Position=1694; Antisense; GGTCCATCGTTCTTCCGAAGGACAA
>probe:Drosophila_2:1639309_at:655:613; Interrogation_Position=1730; Antisense; TGAAGCGGAGAGCTGCTGCACCAAA
>probe:Drosophila_2:1639309_at:520:393; Interrogation_Position=1778; Antisense; GAAATCCCAAACATCTCTCGAACAA
>probe:Drosophila_2:1639309_at:216:121; Interrogation_Position=1817; Antisense; AGCGATGCCCACATACTTACATATA
>probe:Drosophila_2:1639309_at:595:77; Interrogation_Position=1885; Antisense; AGGATGTTCTACTATCTCGTTGTCG
>probe:Drosophila_2:1639309_at:277:637; Interrogation_Position=1901; Antisense; TCGTTGTCGCCCACTGAATGTAATT
>probe:Drosophila_2:1639309_at:688:13; Interrogation_Position=1923; Antisense; ATTAACGTTGCTTTTTGCCAAATAG
>probe:Drosophila_2:1639309_at:659:25; Interrogation_Position=1944; Antisense; ATAGTCGTGGCATAGCGTGCTGCAC
>probe:Drosophila_2:1639309_at:669:121; Interrogation_Position=1957; Antisense; AGCGTGCTGCACGAACTACATATTA
>probe:Drosophila_2:1639309_at:107:727; Interrogation_Position=2012; Antisense; TTGGGACTGGGCTAAACTCTTCGGA
>probe:Drosophila_2:1639309_at:295:433; Interrogation_Position=2035; Antisense; GAGTGCAGAGCTTCCGATGTCCAGA
>probe:Drosophila_2:1639309_at:76:599; Interrogation_Position=2052; Antisense; TGTCCAGACCCGATTTTATCTGTGT
>probe:Drosophila_2:1639309_at:675:71; Interrogation_Position=2109; Antisense; AGGCATTAACGCTTTAGCCAACATG
>probe:Drosophila_2:1639309_at:225:305; Interrogation_Position=2153; Antisense; CCGATTCATCGCTGGGTATATCCTA

Paste this into a BLAST search page for me
GGTCCATCGTTCTTCCGAAGGACAATGAAGCGGAGAGCTGCTGCACCAAAGAAATCCCAAACATCTCTCGAACAAAGCGATGCCCACATACTTACATATAAGGATGTTCTACTATCTCGTTGTCGTCGTTGTCGCCCACTGAATGTAATTATTAACGTTGCTTTTTGCCAAATAGATAGTCGTGGCATAGCGTGCTGCACAGCGTGCTGCACGAACTACATATTATTGGGACTGGGCTAAACTCTTCGGAGAGTGCAGAGCTTCCGATGTCCAGATGTCCAGACCCGATTTTATCTGTGTAGGCATTAACGCTTTAGCCAACATGCCGATTCATCGCTGGGTATATCCTA

Full Affymetrix probeset data:

Annotations for 1639309_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720