FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639310_at:

>probe:Drosophila_2:1639310_at:52:31; Interrogation_Position=1018; Antisense; ATAAAGACGGATCGCGGCCATGGAC
>probe:Drosophila_2:1639310_at:266:67; Interrogation_Position=1037; Antisense; ATGGACACGGCACTTACACCTGTGA
>probe:Drosophila_2:1639310_at:71:667; Interrogation_Position=1051; Antisense; TACACCTGTGAATTCTGCGTGCGGC
>probe:Drosophila_2:1639310_at:397:271; Interrogation_Position=1089; Antisense; CATCGATCTCGAACGGCATGTGTGT
>probe:Drosophila_2:1639310_at:60:437; Interrogation_Position=1114; Antisense; GAGGAACATCCGTAGGGCAGTCAAC
>probe:Drosophila_2:1639310_at:55:569; Interrogation_Position=1129; Antisense; GGCAGTCAACCTAGCCGGAATCGTA
>probe:Drosophila_2:1639310_at:85:565; Interrogation_Position=1145; Antisense; GGAATCGTAGATACCTGAGCGACAT
>probe:Drosophila_2:1639310_at:536:401; Interrogation_Position=1165; Antisense; GACATCTCACGTCCAGAACTACGAT
>probe:Drosophila_2:1639310_at:253:711; Interrogation_Position=854; Antisense; TTCACATCCTCTTGCGCGGTCATGT
>probe:Drosophila_2:1639310_at:232:331; Interrogation_Position=869; Antisense; GCGGTCATGTGTGCGGTATTTGCCA
>probe:Drosophila_2:1639310_at:443:633; Interrogation_Position=902; Antisense; TCGCCACTGCTGATCACCTAAAGAA
>probe:Drosophila_2:1639310_at:655:209; Interrogation_Position=925; Antisense; AAGCACGTTAACAGTCTGCACCTGG
>probe:Drosophila_2:1639310_at:262:39; Interrogation_Position=962; Antisense; ATCTGTGTCCCACGTGCGGAAAGAG
>probe:Drosophila_2:1639310_at:416:393; Interrogation_Position=980; Antisense; GAAAGAGATTCACCCAGCGGTGCCA

Paste this into a BLAST search page for me
ATAAAGACGGATCGCGGCCATGGACATGGACACGGCACTTACACCTGTGATACACCTGTGAATTCTGCGTGCGGCCATCGATCTCGAACGGCATGTGTGTGAGGAACATCCGTAGGGCAGTCAACGGCAGTCAACCTAGCCGGAATCGTAGGAATCGTAGATACCTGAGCGACATGACATCTCACGTCCAGAACTACGATTTCACATCCTCTTGCGCGGTCATGTGCGGTCATGTGTGCGGTATTTGCCATCGCCACTGCTGATCACCTAAAGAAAAGCACGTTAACAGTCTGCACCTGGATCTGTGTCCCACGTGCGGAAAGAGGAAAGAGATTCACCCAGCGGTGCCA

Full Affymetrix probeset data:

Annotations for 1639310_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720