FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639312_at:

>probe:Drosophila_2:1639312_at:275:703; Interrogation_Position=1004; Antisense; TTATTATACATTTCACGCCCTCAAG
>probe:Drosophila_2:1639312_at:108:301; Interrogation_Position=1021; Antisense; CCCTCAAGCGGCGTGTTTTTATAAG
>probe:Drosophila_2:1639312_at:337:717; Interrogation_Position=1083; Antisense; TTCGGGCTAGCCTCAATAAAACAAT
>probe:Drosophila_2:1639312_at:339:211; Interrogation_Position=615; Antisense; AAGAAGGTCTCGCTGCGCTTCACTA
>probe:Drosophila_2:1639312_at:659:681; Interrogation_Position=638; Antisense; TATCGACTGCACCAACATTGCTGAG
>probe:Drosophila_2:1639312_at:483:109; Interrogation_Position=691; Antisense; AGAAGTACATCAAGGCCCGCCTTAA
>probe:Drosophila_2:1639312_at:256:577; Interrogation_Position=704; Antisense; GGCCCGCCTTAAGGTCAACGGCAAG
>probe:Drosophila_2:1639312_at:133:595; Interrogation_Position=739; Antisense; TGGGCAACAACGTCACCTTCGAGCG
>probe:Drosophila_2:1639312_at:87:615; Interrogation_Position=772; Antisense; TGAAGCTCATTGTCAGCTCCGACGT
>probe:Drosophila_2:1639312_at:424:407; Interrogation_Position=792; Antisense; GACGTTCACTTTTCCAAGGCATACC
>probe:Drosophila_2:1639312_at:681:141; Interrogation_Position=862; Antisense; ACTGGATCCGTGTGGTGGCCAACGA
>probe:Drosophila_2:1639312_at:502:169; Interrogation_Position=887; Antisense; AAAGGACTCGTACGAGCTGCGCTAC
>probe:Drosophila_2:1639312_at:511:137; Interrogation_Position=898; Antisense; ACGAGCTGCGCTACTTCAGAATCAG
>probe:Drosophila_2:1639312_at:691:485; Interrogation_Position=961; Antisense; GTAGCTGATCCCTTCAGTGGAATCA

Paste this into a BLAST search page for me
TTATTATACATTTCACGCCCTCAAGCCCTCAAGCGGCGTGTTTTTATAAGTTCGGGCTAGCCTCAATAAAACAATAAGAAGGTCTCGCTGCGCTTCACTATATCGACTGCACCAACATTGCTGAGAGAAGTACATCAAGGCCCGCCTTAAGGCCCGCCTTAAGGTCAACGGCAAGTGGGCAACAACGTCACCTTCGAGCGTGAAGCTCATTGTCAGCTCCGACGTGACGTTCACTTTTCCAAGGCATACCACTGGATCCGTGTGGTGGCCAACGAAAAGGACTCGTACGAGCTGCGCTACACGAGCTGCGCTACTTCAGAATCAGGTAGCTGATCCCTTCAGTGGAATCA

Full Affymetrix probeset data:

Annotations for 1639312_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720