FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639313_at:

>probe:Drosophila_2:1639313_at:561:161; Interrogation_Position=164; Antisense; ACAATTCGAAGCCAAGCGTCCCATA
>probe:Drosophila_2:1639313_at:200:121; Interrogation_Position=178; Antisense; AGCGTCCCATACTAAACTCATCGAA
>probe:Drosophila_2:1639313_at:188:459; Interrogation_Position=212; Antisense; GATATTCGGAGCATCTTTGGGAGAT
>probe:Drosophila_2:1639313_at:313:37; Interrogation_Position=235; Antisense; ATGACATGGACTTCGAGGACTTTCC
>probe:Drosophila_2:1639313_at:382:127; Interrogation_Position=268; Antisense; ACCAACCACTGCCAAATATTTCCAT
>probe:Drosophila_2:1639313_at:340:21; Interrogation_Position=283; Antisense; ATATTTCCATTCACGAGCAACTGCG
>probe:Drosophila_2:1639313_at:20:113; Interrogation_Position=298; Antisense; AGCAACTGCGTCTGGCTTCCGGGAA
>probe:Drosophila_2:1639313_at:281:583; Interrogation_Position=310; Antisense; TGGCTTCCGGGAACCGCGAGATAAT
>probe:Drosophila_2:1639313_at:693:205; Interrogation_Position=360; Antisense; AAGCGACTCGAAAACCTTTGGCACT
>probe:Drosophila_2:1639313_at:443:175; Interrogation_Position=372; Antisense; AACCTTTGGCACTCGGAACTAATAG
>probe:Drosophila_2:1639313_at:398:529; Interrogation_Position=450; Antisense; GGGTTTTCCTTCAGAGATTTCTCAC
>probe:Drosophila_2:1639313_at:594:491; Interrogation_Position=500; Antisense; GTAAAGCCCTGATTACCATGTAAGT
>probe:Drosophila_2:1639313_at:245:53; Interrogation_Position=67; Antisense; ATGACTATCCCATGGAGAGCGAGGA
>probe:Drosophila_2:1639313_at:74:241; Interrogation_Position=99; Antisense; AATAGGCGCAGGAGGGATCTTGATA

Paste this into a BLAST search page for me
ACAATTCGAAGCCAAGCGTCCCATAAGCGTCCCATACTAAACTCATCGAAGATATTCGGAGCATCTTTGGGAGATATGACATGGACTTCGAGGACTTTCCACCAACCACTGCCAAATATTTCCATATATTTCCATTCACGAGCAACTGCGAGCAACTGCGTCTGGCTTCCGGGAATGGCTTCCGGGAACCGCGAGATAATAAGCGACTCGAAAACCTTTGGCACTAACCTTTGGCACTCGGAACTAATAGGGGTTTTCCTTCAGAGATTTCTCACGTAAAGCCCTGATTACCATGTAAGTATGACTATCCCATGGAGAGCGAGGAAATAGGCGCAGGAGGGATCTTGATA

Full Affymetrix probeset data:

Annotations for 1639313_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720