FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639317_at:

>probe:Drosophila_2:1639317_at:624:227; Interrogation_Position=4373; Antisense; AATGGGAGCCCACAATGCGGCGTAC
>probe:Drosophila_2:1639317_at:699:253; Interrogation_Position=4397; Antisense; CAACTACAAGAATGGCGCGGGAGCA
>probe:Drosophila_2:1639317_at:610:267; Interrogation_Position=4574; Antisense; CATGTCGTACTTTAGCGGAGCGGGC
>probe:Drosophila_2:1639317_at:436:441; Interrogation_Position=4611; Antisense; GATGGAGCCGAGAGCCTGACGCACC
>probe:Drosophila_2:1639317_at:358:309; Interrogation_Position=4652; Antisense; CCAGCCCTACATCATATACTCGGAT
>probe:Drosophila_2:1639317_at:586:669; Interrogation_Position=4668; Antisense; TACTCGGATGACAAGGCCTACAGAT
>probe:Drosophila_2:1639317_at:525:281; Interrogation_Position=4743; Antisense; CTCCATTCTGTCCATTTCAATCTTA
>probe:Drosophila_2:1639317_at:463:677; Interrogation_Position=4766; Antisense; TAGTCAGTCAGTCAGGCGCATCGCC
>probe:Drosophila_2:1639317_at:316:269; Interrogation_Position=4784; Antisense; CATCGCCGCAAACAGGTTCTACATT
>probe:Drosophila_2:1639317_at:434:79; Interrogation_Position=4797; Antisense; AGGTTCTACATTATATCGCCGCTCT
>probe:Drosophila_2:1639317_at:84:651; Interrogation_Position=4821; Antisense; TCAGCCACGTTGTATATAGCCTTAA
>probe:Drosophila_2:1639317_at:728:97; Interrogation_Position=4846; Antisense; AGCATTCTAACCGTAACCCTAACTG
>probe:Drosophila_2:1639317_at:640:485; Interrogation_Position=4858; Antisense; GTAACCCTAACTGTATCTATGTCTA
>probe:Drosophila_2:1639317_at:659:85; Interrogation_Position=4893; Antisense; AGTGCAACCAAGTCGCTTATGCGGA

Paste this into a BLAST search page for me
AATGGGAGCCCACAATGCGGCGTACCAACTACAAGAATGGCGCGGGAGCACATGTCGTACTTTAGCGGAGCGGGCGATGGAGCCGAGAGCCTGACGCACCCCAGCCCTACATCATATACTCGGATTACTCGGATGACAAGGCCTACAGATCTCCATTCTGTCCATTTCAATCTTATAGTCAGTCAGTCAGGCGCATCGCCCATCGCCGCAAACAGGTTCTACATTAGGTTCTACATTATATCGCCGCTCTTCAGCCACGTTGTATATAGCCTTAAAGCATTCTAACCGTAACCCTAACTGGTAACCCTAACTGTATCTATGTCTAAGTGCAACCAAGTCGCTTATGCGGA

Full Affymetrix probeset data:

Annotations for 1639317_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720