Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639318_at:

>probe:Drosophila_2:1639318_at:261:123; Interrogation_Position=1457; Antisense; AGCGTTTTGATTACCTGCACGCCAA
>probe:Drosophila_2:1639318_at:486:209; Interrogation_Position=1495; Antisense; AAGCAGCTGGTGATGGACTATGACA
>probe:Drosophila_2:1639318_at:201:141; Interrogation_Position=1555; Antisense; ACGGACGTCGTTGCTGCTCAAGGGC
>probe:Drosophila_2:1639318_at:557:221; Interrogation_Position=1574; Antisense; AAGGGCCCGATCCAGCTGTGGCTAA
>probe:Drosophila_2:1639318_at:7:575; Interrogation_Position=1602; Antisense; GGCGGCCAGGTTAGCCGAACATCAT
>probe:Drosophila_2:1639318_at:309:385; Interrogation_Position=1618; Antisense; GAACATCATCGTCGGCAACATCACG
>probe:Drosophila_2:1639318_at:341:189; Interrogation_Position=1634; Antisense; AACATCACGCCGCAGAGACGATAAA
>probe:Drosophila_2:1639318_at:84:271; Interrogation_Position=1684; Antisense; CATCAGCATCATTTGCAGCGTCATT
>probe:Drosophila_2:1639318_at:521:353; Interrogation_Position=1698; Antisense; GCAGCGTCATTTGCAGCATCATTTG
>probe:Drosophila_2:1639318_at:272:401; Interrogation_Position=1792; Antisense; GACAGTTCGGATAGCTCGGATTCCA
>probe:Drosophila_2:1639318_at:445:405; Interrogation_Position=1843; Antisense; GACTGCGATGATTCCAACTCTAATA
>probe:Drosophila_2:1639318_at:126:445; Interrogation_Position=1876; Antisense; GATGAGGCACGCTACTGATCCTGAT
>probe:Drosophila_2:1639318_at:373:631; Interrogation_Position=1906; Antisense; TCCTGCTGGGACTACTTCGATGAGA
>probe:Drosophila_2:1639318_at:704:127; Interrogation_Position=1930; Antisense; ACCATCCGCAGATTCCCATGTAAAA

Paste this into a BLAST search page for me
AGCGTTTTGATTACCTGCACGCCAAAAGCAGCTGGTGATGGACTATGACAACGGACGTCGTTGCTGCTCAAGGGCAAGGGCCCGATCCAGCTGTGGCTAAGGCGGCCAGGTTAGCCGAACATCATGAACATCATCGTCGGCAACATCACGAACATCACGCCGCAGAGACGATAAACATCAGCATCATTTGCAGCGTCATTGCAGCGTCATTTGCAGCATCATTTGGACAGTTCGGATAGCTCGGATTCCAGACTGCGATGATTCCAACTCTAATAGATGAGGCACGCTACTGATCCTGATTCCTGCTGGGACTACTTCGATGAGAACCATCCGCAGATTCCCATGTAAAA

Full Affymetrix probeset data:

Annotations for 1639318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime