FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639319_at:

>probe:Drosophila_2:1639319_at:590:103; Interrogation_Position=129; Antisense; AGACCGACATCGAGACTGCCAAGTG
>probe:Drosophila_2:1639319_at:379:279; Interrogation_Position=154; Antisense; CTCGAGCACCATTAAGACCCTATTG
>probe:Drosophila_2:1639319_at:391:207; Interrogation_Position=195; Antisense; AAGCGGAGAACGACACTCTTATCCC
>probe:Drosophila_2:1639319_at:50:231; Interrogation_Position=227; Antisense; AATGTGAACTCGACGATCCTGAAGA
>probe:Drosophila_2:1639319_at:453:209; Interrogation_Position=248; Antisense; AAGAAGGTCCTCATTTGGGCCAAGC
>probe:Drosophila_2:1639319_at:623:579; Interrogation_Position=265; Antisense; GGCCAAGCATCATCGCGAGGACATT
>probe:Drosophila_2:1639319_at:589:555; Interrogation_Position=346; Antisense; GGACGCCGAGTTCCTGTCCATGGAT
>probe:Drosophila_2:1639319_at:79:67; Interrogation_Position=365; Antisense; ATGGATCAGGGCACGCTCTTCGAAC
>probe:Drosophila_2:1639319_at:89:645; Interrogation_Position=381; Antisense; TCTTCGAACTCATCTTGGCGGCCAA
>probe:Drosophila_2:1639319_at:95:587; Interrogation_Position=411; Antisense; TGGACATTCCCAATCTGCTGAACGC
>probe:Drosophila_2:1639319_at:131:429; Interrogation_Position=482; Antisense; GAGATTCGCCAGACCTTTCACATAA
>probe:Drosophila_2:1639319_at:211:711; Interrogation_Position=498; Antisense; TTCACATAACCAACGATTTCTCGCC
>probe:Drosophila_2:1639319_at:243:465; Interrogation_Position=625; Antisense; GATTGATGCCTGTTCCGGATTAGAA
>probe:Drosophila_2:1639319_at:502:57; Interrogation_Position=649; Antisense; ATGTAACTCGACATCCTTACCTATG

Paste this into a BLAST search page for me
AGACCGACATCGAGACTGCCAAGTGCTCGAGCACCATTAAGACCCTATTGAAGCGGAGAACGACACTCTTATCCCAATGTGAACTCGACGATCCTGAAGAAAGAAGGTCCTCATTTGGGCCAAGCGGCCAAGCATCATCGCGAGGACATTGGACGCCGAGTTCCTGTCCATGGATATGGATCAGGGCACGCTCTTCGAACTCTTCGAACTCATCTTGGCGGCCAATGGACATTCCCAATCTGCTGAACGCGAGATTCGCCAGACCTTTCACATAATTCACATAACCAACGATTTCTCGCCGATTGATGCCTGTTCCGGATTAGAAATGTAACTCGACATCCTTACCTATG

Full Affymetrix probeset data:

Annotations for 1639319_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720