FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639322_at:

>probe:Drosophila_2:1639322_at:216:25; Interrogation_Position=217; Antisense; ATAGCAACGGCAGCACATTGTGTCT
>probe:Drosophila_2:1639322_at:292:5; Interrogation_Position=233; Antisense; ATTGTGTCTACAACCGCGAGGCGGA
>probe:Drosophila_2:1639322_at:150:163; Interrogation_Position=325; Antisense; AAATTGATTCCCCACGAGTTGTACA
>probe:Drosophila_2:1639322_at:482:467; Interrogation_Position=342; Antisense; GTTGTACAACTCTTCCACTATGGAT
>probe:Drosophila_2:1639322_at:258:149; Interrogation_Position=371; Antisense; ACATTGCCCTGGTGGTTGTGGATCC
>probe:Drosophila_2:1639322_at:420:283; Interrogation_Position=400; Antisense; CTGCCCTTGGATAGCTTTAGCACTA
>probe:Drosophila_2:1639322_at:254:563; Interrogation_Position=426; Antisense; GGAAGCCATTGAAATCGCCTCGGAG
>probe:Drosophila_2:1639322_at:439:423; Interrogation_Position=502; Antisense; GAGAACGGCTTGTCATCCGATCAAC
>probe:Drosophila_2:1639322_at:605:655; Interrogation_Position=537; Antisense; TAAGGTACCAATTGTCGATTCCGAA
>probe:Drosophila_2:1639322_at:154:73; Interrogation_Position=569; Antisense; AGGAAGCCTACTACTGGCGACCGAT
>probe:Drosophila_2:1639322_at:127:53; Interrogation_Position=604; Antisense; ATGCTCTGCGCTGGACTATCGGAGG
>probe:Drosophila_2:1639322_at:276:549; Interrogation_Position=658; Antisense; GGAGGACCTCTGGTTGTTGCTAACA
>probe:Drosophila_2:1639322_at:200:469; Interrogation_Position=673; Antisense; GTTGCTAACAAGCTGGCCGGCATTG
>probe:Drosophila_2:1639322_at:653:371; Interrogation_Position=709; Antisense; GAAGGATGCGCACGTCCAAATTATC

Paste this into a BLAST search page for me
ATAGCAACGGCAGCACATTGTGTCTATTGTGTCTACAACCGCGAGGCGGAAAATTGATTCCCCACGAGTTGTACAGTTGTACAACTCTTCCACTATGGATACATTGCCCTGGTGGTTGTGGATCCCTGCCCTTGGATAGCTTTAGCACTAGGAAGCCATTGAAATCGCCTCGGAGGAGAACGGCTTGTCATCCGATCAACTAAGGTACCAATTGTCGATTCCGAAAGGAAGCCTACTACTGGCGACCGATATGCTCTGCGCTGGACTATCGGAGGGGAGGACCTCTGGTTGTTGCTAACAGTTGCTAACAAGCTGGCCGGCATTGGAAGGATGCGCACGTCCAAATTATC

Full Affymetrix probeset data:

Annotations for 1639322_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720