Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639323_at:

>probe:Drosophila_2:1639323_at:34:693; Interrogation_Position=109; Antisense; TTTGCTTGGGCTATTCTGACGAGGA
>probe:Drosophila_2:1639323_at:599:399; Interrogation_Position=144; Antisense; GACAGCCTTAGGGTTGCAGAAATTA
>probe:Drosophila_2:1639323_at:490:395; Interrogation_Position=162; Antisense; GAAATTATTCGAACCTCCAACGACG
>probe:Drosophila_2:1639323_at:71:481; Interrogation_Position=17; Antisense; GTTTGTCTTAAACCAGTGCTCTACT
>probe:Drosophila_2:1639323_at:338:97; Interrogation_Position=196; Antisense; AGATCAATCGAACCCAAGAGCTGCT
>probe:Drosophila_2:1639323_at:389:621; Interrogation_Position=217; Antisense; TGCTCGATATCTTTAGGCGCCTGAC
>probe:Drosophila_2:1639323_at:220:389; Interrogation_Position=358; Antisense; GAAAAATCCTATCTCCAGTGGCACA
>probe:Drosophila_2:1639323_at:149:357; Interrogation_Position=378; Antisense; GCACAAGGCCTTGCAGTTGGATTCT
>probe:Drosophila_2:1639323_at:88:725; Interrogation_Position=403; Antisense; TTGAAGAACTCGGTGGCAGCCTTTC
>probe:Drosophila_2:1639323_at:601:125; Interrogation_Position=420; Antisense; AGCCTTTCCAGGCTCTTTACTGGAT
>probe:Drosophila_2:1639323_at:126:543; Interrogation_Position=441; Antisense; GGATAATCACCATTCAGGACTAAGG
>probe:Drosophila_2:1639323_at:253:179; Interrogation_Position=486; Antisense; AAACATGTTGTAAGCTCAAGTCCAA
>probe:Drosophila_2:1639323_at:74:231; Interrogation_Position=56; Antisense; AATGAATGCCTCCATTTCTCTACTA
>probe:Drosophila_2:1639323_at:232:335; Interrogation_Position=92; Antisense; GCTCCTGATTAGTCCTTTTTGCTTG

Paste this into a BLAST search page for me
TTTGCTTGGGCTATTCTGACGAGGAGACAGCCTTAGGGTTGCAGAAATTAGAAATTATTCGAACCTCCAACGACGGTTTGTCTTAAACCAGTGCTCTACTAGATCAATCGAACCCAAGAGCTGCTTGCTCGATATCTTTAGGCGCCTGACGAAAAATCCTATCTCCAGTGGCACAGCACAAGGCCTTGCAGTTGGATTCTTTGAAGAACTCGGTGGCAGCCTTTCAGCCTTTCCAGGCTCTTTACTGGATGGATAATCACCATTCAGGACTAAGGAAACATGTTGTAAGCTCAAGTCCAAAATGAATGCCTCCATTTCTCTACTAGCTCCTGATTAGTCCTTTTTGCTTG

Full Affymetrix probeset data:

Annotations for 1639323_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime