FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639324_at:

>probe:Drosophila_2:1639324_at:516:363; Interrogation_Position=133; Antisense; GAATTATTCACAATGGCCCGTTCCA
>probe:Drosophila_2:1639324_at:304:117; Interrogation_Position=193; Antisense; AGCTACTGGGCTTGCGAGGTACGAA
>probe:Drosophila_2:1639324_at:200:101; Interrogation_Position=287; Antisense; AGAGGACCTCTAGCGATAGCATATC
>probe:Drosophila_2:1639324_at:706:191; Interrogation_Position=352; Antisense; AACTATTCATGTCCGCACTCAAAAG
>probe:Drosophila_2:1639324_at:540:131; Interrogation_Position=423; Antisense; ACCGCACCACATGATCTTTCGAAAG
>probe:Drosophila_2:1639324_at:539:391; Interrogation_Position=443; Antisense; GAAAGATGGCCTACAAGTCCTCCGC
>probe:Drosophila_2:1639324_at:517:587; Interrogation_Position=485; Antisense; TGGATGGTAGTATCTTCTGTCCCGC
>probe:Drosophila_2:1639324_at:258:505; Interrogation_Position=527; Antisense; GTCCAGTGGTCAAATGCGCATCCGG
>probe:Drosophila_2:1639324_at:626:265; Interrogation_Position=561; Antisense; CAGATGGTGTTCATGGGCCTTTTGC
>probe:Drosophila_2:1639324_at:453:705; Interrogation_Position=587; Antisense; TTATGCCCTGTCTGAAGAGCTCGGA
>probe:Drosophila_2:1639324_at:280:365; Interrogation_Position=621; Antisense; GAATATATACTGTGGCCATTGCAAC
>probe:Drosophila_2:1639324_at:627:5; Interrogation_Position=638; Antisense; ATTGCAACACCTTTTTGGGCGCCTT
>probe:Drosophila_2:1639324_at:632:523; Interrogation_Position=654; Antisense; GGGCGCCTTCAATCGCGAGAAGCAA
>probe:Drosophila_2:1639324_at:383:369; Interrogation_Position=672; Antisense; GAAGCAAAGTCTCAAGCCGAACAAG

Paste this into a BLAST search page for me
GAATTATTCACAATGGCCCGTTCCAAGCTACTGGGCTTGCGAGGTACGAAAGAGGACCTCTAGCGATAGCATATCAACTATTCATGTCCGCACTCAAAAGACCGCACCACATGATCTTTCGAAAGGAAAGATGGCCTACAAGTCCTCCGCTGGATGGTAGTATCTTCTGTCCCGCGTCCAGTGGTCAAATGCGCATCCGGCAGATGGTGTTCATGGGCCTTTTGCTTATGCCCTGTCTGAAGAGCTCGGAGAATATATACTGTGGCCATTGCAACATTGCAACACCTTTTTGGGCGCCTTGGGCGCCTTCAATCGCGAGAAGCAAGAAGCAAAGTCTCAAGCCGAACAAG

Full Affymetrix probeset data:

Annotations for 1639324_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720