FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639327_at:

>probe:Drosophila_2:1639327_at:510:653; Interrogation_Position=449; Antisense; TCAAGTACTCAGTTCCGCATCAGAA
>probe:Drosophila_2:1639327_at:482:613; Interrogation_Position=539; Antisense; TGAAGGCTCTGCTAAAAATCCACGA
>probe:Drosophila_2:1639327_at:64:497; Interrogation_Position=577; Antisense; GTCATCGCTGATATACATTCCCTGA
>probe:Drosophila_2:1639327_at:322:301; Interrogation_Position=596; Antisense; CCCTGATCGCCACTATTAACTATTT
>probe:Drosophila_2:1639327_at:418:215; Interrogation_Position=640; Antisense; AAGATAAAGATCACTCCAGCGGAGG
>probe:Drosophila_2:1639327_at:573:521; Interrogation_Position=663; Antisense; GGGCTCCAGGCCGTCAATAAAGGCT
>probe:Drosophila_2:1639327_at:193:271; Interrogation_Position=694; Antisense; GAATTGGATCGGCTGCGCAAGACCA
>probe:Drosophila_2:1639327_at:230:357; Interrogation_Position=725; Antisense; GCAACCACTACACGCGGGAAATTAT
>probe:Drosophila_2:1639327_at:703:47; Interrogation_Position=769; Antisense; ATCCTTGACCATGTGCCGCAATTGA
>probe:Drosophila_2:1639327_at:216:203; Interrogation_Position=794; Antisense; AACCAAACATTTTCGACGCTCTGGG
>probe:Drosophila_2:1639327_at:22:165; Interrogation_Position=838; Antisense; AAATCCAAGCACTGAACCGTTTCTG
>probe:Drosophila_2:1639327_at:606:383; Interrogation_Position=917; Antisense; GAACATGCTCTATGCTACGCTAGTT
>probe:Drosophila_2:1639327_at:125:715; Interrogation_Position=940; Antisense; TTCTGTCCTGCGTCAGTTTGATATA
>probe:Drosophila_2:1639327_at:112:241; Interrogation_Position=975; Antisense; AATAATCTCATTTAGCTCGGGCAAA

Paste this into a BLAST search page for me
TCAAGTACTCAGTTCCGCATCAGAATGAAGGCTCTGCTAAAAATCCACGAGTCATCGCTGATATACATTCCCTGACCCTGATCGCCACTATTAACTATTTAAGATAAAGATCACTCCAGCGGAGGGGGCTCCAGGCCGTCAATAAAGGCTGAATTGGATCGGCTGCGCAAGACCAGCAACCACTACACGCGGGAAATTATATCCTTGACCATGTGCCGCAATTGAAACCAAACATTTTCGACGCTCTGGGAAATCCAAGCACTGAACCGTTTCTGGAACATGCTCTATGCTACGCTAGTTTTCTGTCCTGCGTCAGTTTGATATAAATAATCTCATTTAGCTCGGGCAAA

Full Affymetrix probeset data:

Annotations for 1639327_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720